[Home] | [Total List]

[177575_at]

Description T04D3.2 /REP_DB=WormBase Gene ID /WP=CE13155 /TR=O02297 /GB=CAB03286.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 78      4grp_total > 0      6grp_cgc > 49      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/177575_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 26
1 2 3 4 range
A 6.1
(-2.1)
A
2.3
(-3)
A
2.2
(-3)
A
27.4
(3)
A
25
B 2.2
(-3)
A
4.3
(-2.2)
A
17.7
(3)
A
7.1
(-1.1)
A
16
C 2.1
(-2)
A
1
(-3)
A
4.2
(-0.1)
A
7.6
(3)
A
7
avr 3.5
(-2.5)
2.5
(-3)
8
(-0.1)
14
(3)
12

Warning: fopen(./gnuplot/177575_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 61
1 2 3 4 5 6 range
A 2.5
(-2.8)
A
2.1
(-2.9)
A
0.9
(-3)
A
1.5
(-2.9)
A
2
(-2.9)
A
61
(3)
P
60
B 0.9
(-3)
A
1.6
(-2.9)
A
1.4
(-2.9)
A
0.5
(-3)
A
21.5
(-0.9)
A
60
(3)
P
60
C 1.8
(-2.9)
A
2.1
(-2.9)
A
1.3
(-3)
A
3.7
(-2.8)
A
31.5
(0.1)
A
60.5
(3)
P
59
avr 1.7
(-2.9)
1.9
(-2.9)
1.2
(-3)
1.9
(-2.9)
18.3
(-1.3)
60.5
(3)
59
No Scale

Warning: fopen(./gnuplot/177575_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4
1 2 3 4 range
A 2.2
(-0.1)
A
0.5
(-3)
A
0.6
(-2.8)
A
4
(3)
A
4
B 0.7
(-3)
A
1.1
(-2.3)
A
4.1
(3)
A
1.5
(-1.6)
A
3
C 0.7
(-0.8)
A
0.3
(-3)
A
1.4
(3)
A
1.3
(2.5)
A
1
avr 1.2
(-0.9)
0.6
(-3)
2
(1.9)
2.3
(3)
2

Warning: fopen(./gnuplot/177575_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177575_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 22
1 2 3 4 5 6 range
A 0.5
(-2.9)
A
0.7
(-2.8)
A
0.2
(-3)
A
0.4
(-2.9)
A
0.6
(-2.8)
A
14.9
(3)
P
15
B 0.3
(-2.9)
A
0.5
(-2.9)
A
0.3
(-2.9)
A
0.1
(-3)
A
8.7
(-0.7)
A
22.4
(3)
P
22
C 0.7
(-2.9)
A
0.6
(-2.9)
A
0.3
(-3)
A
0.7
(-2.9)
A
10.2
(-0)
A
20.3
(3)
P
20
avr 0.5
(-2.9)
0.6
(-2.9)
0.3
(-3)
0.4
(-3)
6.5
(-1)
19.2
(3)
19
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177575_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1517
Sequence Type Exemplar sequence
Representative Public ID T04D3.2 NCBI
Target Description T04D3.2 /REP_DB=WormBase Gene ID /WP=CE13155 /TR=O02297 /GB=CAB03286.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060940(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060940 NCBI Caenorhabditis elegans T04D3.2 (T04D3.2) mRNA, complete cds. 11/11 None
SNAP00000016260 ENSEMBL cdna:SNAP chromosome:CEL140:I:13315170:13316804:1 11/11 None
GENEFINDER00000016276 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:13315170:13316804:1 11/11 None
T04D3.2 ENSEMBL cdna:known chromosome:CEL140:I:13314324:13316804:1 gene:T04D3.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:13314254-13316735(+) 92.84 100.0
Public Domain and Genome References
Gene Title
Gene Symbol sdz-30
Ensembl T04D3.2
Entrez Gene 173198 Entrez gene
SwissProt O02297 EMBL-EBI
WormBase CE13155 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5509 calcium ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03286 Hypothetical protein T04D3.2 [Caenorhabditis elegans] ref|NP_493341.1| T04D3.2 [Caenorhabditis elegans] 0.0
blast CAB03290 Hypothetical protein M01E5.6 [Caenorhabditis elegans] emb|CAB07643.1| Hypothetical protein M01E5.6 [Caenorhabditis elegans] ref|NP_493339.1| M01E5.6 [Caenorhabditis elegans] 7.0E-51
blast CAB03290 Hypothetical protein M01E5.6 [Caenorhabditis elegans] emb|CAB07643.1| Hypothetical protein M01E5.6 [Caenorhabditis elegans] ref|NP_493339.1| M01E5.6 [Caenorhabditis elegans] 8.0E-51
blast CAB04980 Hypothetical protein ZK1053.4 [Caenorhabditis elegans] ref|NP_493323.1| ZK1053.4 [Caenorhabditis elegans] 5.0E-43
Sequence
Target Sequence
>C. ELEGANS:177575_AT
acccaaagtcatgttctagcagtaatcaatcggaatgatctaccacaaccggttgtagaa
gtgattgttaggaacttgtatggaaaaattcgaaaggagattccagaaatgtatggcttc
attcagacaccagttactgtgaaaactttcatagttcaaatggaagaggaacggagaaag
aagacaaaaatcatctatgataaggttcaattggcgaagaagaagaataaggagataaaa
ttgaagaagaaagttctggaagaagaggaaaaaactgagaaaatgatggaaaatatgact
ctagagaattctgaagatcagtctaagaaggatgaagcaacagtggatgctgaaattaga
acggaagaaagcgataatcctttcaaaagaattccggtaatcgatgctcaaaaacgactt
atcgatgcgatatttcaaaggcagatcgattgtaatattgaagacagtgagaagcaacgg
atcaatattgacattcagagaggacttaaatggtttcaagaatgcaaagaagcaaggaaa
aggaaagaagctgaagcggcacagaagaccttggagcaaaagcatagagcagcacta


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACCCAAAGTCATGTTCTAGCAGTAA 647 89 1198 Antisense
CATGTTCTAGCAGTAATCAATCGGA 586 207 1207 Antisense
GAATGATCTACCACAACCGGTTGTA 705 329 1230 Antisense
ACCGGTTGTAGAAGTGATTGTTAGG 569 87 1245 Antisense
GAGATTCCAGAAATGTATGGCTTCA 615 397 1294 Antisense
ATGGCTTCATTCAGACACCAGTTAC 466 51 1310 Antisense
GACACCAGTTACTGTGAAAACTTTC 12 367 1323 Antisense
AAAGAATTCCGGTAATCGATGCTCA 349 123 1583 Antisense
GCTCAAAAACGACTTATCGATGCGA 619 301 1603 Antisense
GAAGCGGCACAGAAGACCTTGGAGC 193 343 1750 Antisense
GGAGCAAAAGCATAGAGCAGCACTA 84 521 1770 Antisense
Sequence Source Affymetrix Proprietary Database