[Home] | [Total List]

[177545_at]

Description F19B2.7 /REP_DB=WormBase Gene ID /WP=CE20699 /TR=Q9XXS5 /GB=CAA16274.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 12      4grp_total > 27      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/177545_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 59
1 2 3 4 range
A 26.9
(0.1)
A
5.3
(-3)
A
10.9
(-2.2)
A
46.9
(3)
A
42
B 21.2
(-1.2)
A
62.6
(3)
A
4.1
(-3)
A
6.2
(-2.8)
A
59
C 5.2
(-3)
A
14.7
(-1.9)
A
5.3
(-3)
A
58.3
(3)
A
53
avr 17.8
(-0.8)
27.5
(1.1)
6.8
(-3)
37.1
(3)
30

Warning: fopen(./gnuplot/177545_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 38
1 2 3 4 5 6 range
A 24.2
(0.9)
A
33.8
(2.5)
A
36.4
(3)
A
4.1
(-2.6)
A
1.8
(-3)
A
6.5
(-2.2)
A
35
B 17.2
(-1)
A
6.9
(-2.9)
A
9.1
(-2.5)
A
39.3
(3)
A
11.3
(-2.1)
A
6.3
(-3)
A
33
C 14.2
(-1.5)
A
38.9
(3)
A
5.6
(-3)
A
6.3
(-2.9)
A
6.2
(-2.9)
A
6.8
(-2.8)
A
33
avr 18.5
(0.6)
26.5
(3)
17
(0.2)
16.6
(0)
6.4
(-3)
6.5
(-3)
20
No Scale

Warning: fopen(./gnuplot/177545_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 15
1 2 3 4 range
A 9.8
(3)
A
1.1
(-3)
A
2.9
(-1.8)
A
6.9
(1)
A
9
B 6.7
(-0.6)
A
15.5
(3)
A
1
(-3)
A
1.3
(-2.9)
A
15
C 1.7
(-3)
A
4.2
(-1.1)
A
1.8
(-2.9)
A
9.8
(3)
A
8
avr 6.1
(2)
6.9
(3)
1.9
(-3)
6
(1.9)
5

Warning: fopen(./gnuplot/177545_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177545_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12
1 2 3 4 5 6 range
A 4.5
(-0.9)
A
12
(3)
A
7.9
(0.9)
A
1
(-2.7)
A
0.5
(-3)
A
1.6
(-2.4)
A
12
B 6
(-0.2)
A
2.3
(-2.9)
A
2.2
(-3)
A
10.4
(3)
A
4.6
(-1.2)
A
2.4
(-2.9)
A
8
C 5.2
(-0.8)
A
11.9
(3)
A
1.4
(-2.9)
A
1.3
(-3)
A
2
(-2.6)
A
2.3
(-2.4)
A
11
avr 5.2
(-0.2)
8.7
(3)
3.8
(-1.5)
4.2
(-1.1)
2.4
(-2.7)
2.1
(-3)
7
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177545_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14407
Sequence Type Exemplar sequence
Representative Public ID F19B2.7 NCBI
Target Description F19B2.7 /REP_DB=WormBase Gene ID /WP=CE20699 /TR=Q9XXS5 /GB=CAA16274.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_075483(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_075483 NCBI Caenorhabditis elegans F19B2.7 (F19B2.7) mRNA, complete cds. 11/11 A 
GENEFINDER00000019295 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:20149486:20153308:1 11/11 None
F19B2.7 ENSEMBL cdna:known chromosome:CEL140:V:20147014:20153308:1 gene:F19B2.7 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_075481 1/11 Cross Hyb Matching Probes None
SNAP00000019284 5/11 Cross Hyb Matching Probes None
Y113G7A.12 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:20147013-20153308(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F19B2.7
Entrez Gene 184665 Entrez gene
SwissProt Q9XXS5 EMBL-EBI
WormBase CE20699 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6508 proteolysis inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4176 ATP-dependent peptidase activity inferred from electronic annotation QuickGO AmiGO
4252 serine-type endopeptidase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA16274 Hypothetical protein F19B2.7 [Caenorhabditis elegans] ref|NP_507884.1| F19B2.7 [Caenorhabditis elegans] 0.0
blast CAA16274 Hypothetical protein F19B2.7 [Caenorhabditis elegans] ref|NP_507884.1| F19B2.7 [Caenorhabditis elegans] 1.0E-105
blast NP_494509 F14D2.7 [Caenorhabditis elegans] gb|AAB94961.1| Hypothetical protein F14D2.7 [Caenorhabditis elegans] 3.0E-21
Sequence
Target Sequence
>C. ELEGANS:177545_AT
gcaagctcggcaacgccaacaagaacatccaaacgtgtcggatgcacagaatttgagtga
cgtcagtcgtagtaattcatcgacactcaacatagcatcgtgttatggactctcagaaaa
gacgatagatcaggaaatgaaaattgcataccccatgagaatcacgtgttcctgggtcaa
ttacaaagaattgaaatttgagtttgccggaaaaagaaatgacgacaaagaatcagttgc
aataacagctttcgaggctgttatgaagcatatgtcgttgaaagaaaagaaagtggacag
gatgattttgttgcaatttgaaacactcgttcgaatgagaggaaatagtggaggagtcgc
tgctgcaatagcgattgaagcagcaattcttggaatacgtataccaaattctattgcggt
gactggcgcaataaatgaagagggcgaagtgctccctgtgagtgatattgtcgacatggt
cacgcattgcttcgatgagaacattgaatccgtgattgtaccgctttctaacgactctga
aattccggagcaact


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GCAAGCTCGGCAACGCCAACAAGAA 436 321 771 Antisense
GTGACGTCAGTCGTAGTAATTCATC 203 483 827 Antisense
ATTCATCGACACTCAACATAGCATC 174 11 845 Antisense
ATAGCATCGTGTTATGGACTCTCAG 230 23 862 Antisense
GCATACCCCATGAGAATCACGTGTT 625 307 916 Antisense
ATCACGTGTTCCTGGGTCAATTACA 278 23 931 Antisense
GTTGCAATTTGAAACACTCGTTCGA 127 439 1080 Antisense
ATAGTGGAGGAGTCGCTGCTGCAAT 468 21 1115 Antisense
TGAATCCGTGATTGTACCGCTTTCT 604 575 1275 Antisense
GATTGTACCGCTTTCTAACGACTCT 566 433 1284 Antisense
ACGACTCTGAAATTCCGGAGCAACT 329 93 1301 Antisense
Sequence Source Affymetrix Proprietary Database