[Home] | [Total List]

[177474_at] 7TM receptor, sre family

Description F15A4.3 /REP_DB=WormBase Gene ID /WP=CE15840 /TR=O17818 /GB=CAB02947.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 21      4grp_total > 10      6grp_cgc > 44      6grp_cgc_sub > 02      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/177474_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 49
1 2 3 4 range
A 7.2
(-3)
A
9.8
(-2.7)
A
11.3
(-2.5)
A
52.4
(3)
A
45
B 16.6
(3)
A
16.2
(2.8)
A
10.4
(0.2)
A
3.3
(-3)
A
13
C 4
(-3)
A
10.3
(0.6)
A
7.1
(-1.2)
A
14.5
(3)
A
11
avr 9.3
(-3)
12.1
(-1.8)
9.6
(-2.9)
23.4
(3)
14

Warning: fopen(./gnuplot/177474_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 47
1 2 3 4 5 6 range
A 10.9
(-1.6)
A
8.5
(-2.1)
A
33
(3)
A
5.8
(-2.6)
A
3.9
(-3)
A
4
(-3)
A
29
B 6.4
(-1.7)
A
2.4
(-3)
A
20.3
(3)
A
3
(-2.8)
A
6.3
(-1.7)
A
4.4
(-2.3)
A
18
C 3.7
(-3)
A
49.2
(3)
A
4
(-3)
A
9.2
(-2.3)
A
5.2
(-2.8)
A
15.1
(-1.5)
A
46
avr 7
(-2.2)
20
(3)
19.1
(2.6)
6
(-2.6)
5.1
(-3)
7.8
(-1.9)
15
No Scale

Warning: fopen(./gnuplot/177474_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 7
1 2 3 4 range
A 2.6
(-2.5)
A
2.1
(-3)
A
2.9
(-2.1)
A
7.7
(3)
A
6
B 5.3
(3)
A
4
(1.3)
A
2.4
(-0.8)
A
0.7
(-3)
A
5
C 1.3
(-3)
A
3
(3)
A
2.5
(1.2)
A
2.4
(0.9)
A
2
avr 3.1
(0)
3
(-0.6)
2.6
(-3)
3.6
(3)
1

Warning: fopen(./gnuplot/177474_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177474_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 14
1 2 3 4 5 6 range
A 2
(-2)
A
3
(-1.1)
A
7.2
(3)
A
1.5
(-2.5)
A
1.2
(-2.8)
A
1
(-3)
A
6
B 2.2
(-1)
A
0.8
(-3)
A
4.9
(3)
A
0.8
(-3)
A
2.6
(-0.4)
A
1.7
(-1.7)
A
4
C 1.4
(-2.8)
A
15
(3)
A
1
(-3)
A
1.8
(-2.7)
A
1.7
(-2.7)
A
5.1
(-1.2)
A
14
avr 1.9
(-2.4)
6.3
(3)
4.4
(0.7)
1.4
(-3)
1.8
(-2.5)
2.6
(-1.5)
5
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177474_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3408
Sequence Type Exemplar sequence
Representative Public ID F15A4.3 NCBI
Target Description F15A4.3 /REP_DB=WormBase Gene ID /WP=CE15840 /TR=O17818 /GB=CAB02947.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064254(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_064254 NCBI Caenorhabditis elegans Serpentine Receptor, class E (epsilon) family member (sre-37) (sre-37) mRNA, complete cds. 11/11 None
GENEFINDER00000042557 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:12465775:12469280:1 11/11 None
F15A4.3 ENSEMBL cdna:known chromosome:CEL140:II:12465775:12467422:1 gene:F15A4.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:12465771-12467102(+) 100.0 100.0
Public Domain and Genome References
Gene Title 7TM receptor, sre family
Gene Symbol sre-37
Ensembl F15A4.3
Entrez Gene 184512 Entrez gene
SwissProt O17818 EMBL-EBI
WormBase CE37894 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7606 sensory perception of chemical stimulus inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4888 transmembrane receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB02947 Hypothetical protein F15A4.3 [Caenorhabditis elegans] ref|NP_496655.2| Serpentine Receptor, class E (epsilon) family member (sre-37) [Caenorhabditis elegans] sp|O17818|SRE37_CAEEL Serpentine receptor class epsilon-37 (Protein sre-37) 0.0
blast CAB02947 Hypothetical protein F15A4.3 [Caenorhabditis elegans] ref|NP_496655.2| Serpentine Receptor, class E (epsilon) family member (sre-37) [Caenorhabditis elegans] sp|O17818|SRE37_CAEEL Serpentine receptor class epsilon-37 (Protein sre-37) 1.0E-155
blast CAB02948 Hypothetical protein F15A4.4 [Caenorhabditis elegans] ref|NP_496656.2| Serpentine Receptor, class G (gamma) family member (srg-16) [Caenorhabditis elegans] sp|O17819|SRG16_CAEEL Serpentine receptor class gamma-16 (Protein srg-16) 1.0E-133
blast CAE73495 Hypothetical protein CBG20952 [Caenorhabditis briggsae] 5.0E-99
blast CAE73495 Hypothetical protein CBG20952 [Caenorhabditis briggsae] 1.0E-98
blast CAE73494 Hypothetical protein CBG20951 [Caenorhabditis briggsae] 6.0E-78
Protein Domains
Database ID Description E-Value
Pfam IPR004151 EMBL-EBI C. elegans Sre G protein-coupled chemoreceptor 2.5E-67
Pfam IPR000609 EMBL-EBI Integral membrane protein Srg, nematode type 1.6E-62
Pfam IPR004151 EMBL-EBI C. elegans Sre G protein-coupled chemoreceptor 3.3E-82
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_496655.2 7 29-51,72-94,128-150,170-189,204-223,260-282,287-309
F15A4.3 7 29-51,72-94,128-150,170-189,204-223,260-282,287-309
GENEFINDER00000042557 11 29-51,72-94,128-150,170-189,204-223,260-279,416-438,485-507,532-554,567-589,609-631
Sequence
Target Sequence
>C. ELEGANS:177474_AT
aatcggcaattcttcgggaggacgtcaatatttggccgatttactttgcaagctactttc
tatggcattatatgtattcgatactttttgccgtgttggctgtcgggttggagagggtct
gtgccacgtggtatatacaagattacgaacacgtgagtcgacgtcatatcccaattttgt
taatagctgccacaaatctaatcacccttccgtacgcgtatcaaaccaccaacaaccgga
caccacttctccaaacatgtctgcagagcattttcattggctcggttgcagttttcgggt
atataatgctgtggagggtgaacctggcgtggcggaatcgaatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AATCGGCAATTCTTCGGGAGGACGT 212 167 353 Antisense
GCAAGCTACTTTCTATGGCATTATA 609 319 400 Antisense
ATTCGATACTTTTTGCCGTGTTGGC 47 3 428 Antisense
TTGGCTGTCGGGTTGGAGAGGGTCT 568 701 448 Antisense
GGGTCTGTGCCACGTGGTATATACA 615 497 467 Antisense
AGTCGACGTCATATCCCAATTTTGT 373 61 508 Antisense
TAGCTGCCACAAATCTAATCACCCT 100 653 536 Antisense
TATCAAACCACCAACAACCGGACAC 167 657 571 Antisense
CCACTTCTCCAAACATGTCTGCAGA 511 275 595 Antisense
TCATTGGCTCGGTTGCAGTTTTCGG 657 617 626 Antisense
GAACCTGGCGTGGCGGAATCGAATT 201 347 672 Antisense
Sequence Source Affymetrix Proprietary Database