[Home] | [Total List]

[177464_at]

Description F57G8.1 /REP_DB=WormBase Gene ID /WP=CE18775 /TR=Q9XU91 /GB=CAB05532.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 34      4grp_total > 03      6grp_cgc > 44      6grp_cgc_sub > 02      6grp_total_sub > Decrease      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/177464_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 160
1 2 3 4 range
A 34.9
(-1.6)
A
15.1
(-3)
A
32.3
(-1.8)
A
99.2
(3)
P
84
B 51
(3)
A
36.4
(1.2)
A
3.4
(-3)
A
48.1
(2.6)
P
48
C 5.5
(-3)
A
15.7
(-2.6)
A
13.3
(-2.7)
A
163.2
(3)
P
158
avr 30.5
(-2)
22.4
(-2.6)
16.3
(-3)
103.5
(3)
87

Warning: fopen(./gnuplot/177464_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 61
1 2 3 4 5 6 range
A 35.5
(3)
A
6.3
(-3)
A
10.3
(-2.2)
A
14.7
(-1.3)
A
23
(0.4)
A
24.8
(0.8)
A
29
B 23.2
(1)
A
32.7
(3)
A
4.3
(-3)
A
10.1
(-1.8)
A
30
(2.4)
A
14.4
(-0.9)
A
28
C 17.7
(-2.4)
A
40.7
(0.2)
A
65
(3)
A
20.5
(-2.1)
A
12.6
(-3)
A
13.1
(-2.9)
A
52
avr 25.5
(2.4)
26.6
(3)
26.5
(2.9)
15.1
(-3)
21.9
(0.5)
17.4
(-1.8)
12
No Scale

Warning: fopen(./gnuplot/177464_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 27
1 2 3 4 range
A 12.7
(2)
A
3.3
(-3)
A
8.4
(-0.3)
A
14.5
(3)
P
11
B 16.3
(3)
A
9
(0.2)
A
0.8
(-3)
A
10.2
(0.6)
P
16
C 1.8
(-3)
A
4.5
(-2.4)
A
4.6
(-2.3)
A
27.5
(3)
P
26
avr 10.3
(-0.3)
5.6
(-2.5)
4.6
(-3)
17.4
(3)
13

Warning: fopen(./gnuplot/177464_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177464_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 16
1 2 3 4 5 6 range
A 6.5
(2.5)
A
2.2
(-3)
A
2.3
(-2.9)
A
3.7
(-1.1)
A
6.9
(3)
A
6
(1.9)
A
5
B 8.1
(0.8)
A
10.9
(2.3)
A
1
(-3)
A
2.7
(-2.1)
A
12.2
(3)
A
5.4
(-0.6)
A
11
C 6.6
(-1.8)
A
12.4
(1)
A
16.6
(3)
A
4.1
(-3)
A
4.1
(-3)
A
4.4
(-2.9)
A
13
avr 7.1
(1.3)
8.5
(3)
6.6
(0.7)
3.5
(-3)
7.7
(2)
5.3
(-0.8)
5
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177464_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14199
Sequence Type Exemplar sequence
Representative Public ID F57G8.1 NCBI
Target Description F57G8.1 /REP_DB=WormBase Gene ID /WP=CE18775 /TR=Q9XU91 /GB=CAB05532.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074722(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074722 NCBI Caenorhabditis elegans Serpentine Receptor, class H family member (srh-180) (srh-180) mRNA, complete cds. 11/11 None
GENEFINDER00000042085 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:16320282:16321388:1 11/11 None
F57G8.1 ENSEMBL cdna:known chromosome:CEL140:V:16320150:16321388:1 gene:F57G8.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:16320149-16321388(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol srh-180
Ensembl F57G8.1
Entrez Gene 186464 Entrez gene
SwissProt Q9XU91 EMBL-EBI
WormBase CE18775 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05532 Hypothetical protein F57G8.1 [Caenorhabditis elegans] ref|NP_507123.1| Serpentine Receptor, class H family member (srh-180) [Caenorhabditis elegans] 0.0
blast CAB05532 Hypothetical protein F57G8.1 [Caenorhabditis elegans] ref|NP_507123.1| Serpentine Receptor, class H family member (srh-180) [Caenorhabditis elegans] 1.0E-162
blast CAA98445 Hypothetical protein D1054.12 [Caenorhabditis elegans] ref|NP_505760.2| Serpentine Receptor, class H family member (srh-184) [Caenorhabditis elegans] 1.0E-103
blast CAB04999 Hypothetical protein ZK228.8 [Caenorhabditis elegans] emb|CAA16412.1| Hypothetical protein ZK228.8 [Caenorhabditis elegans] ref|NP_507619.1| Serpentine Receptor, class H family member (srh-178) [Caenorhabditis elegans] 1.0E-95
blast CAA98445 Hypothetical protein D1054.12 [Caenorhabditis elegans] ref|NP_505760.2| Serpentine Receptor, class H family member (srh-184) [Caenorhabditis elegans] 1.0E-85
blast CAB04999 Hypothetical protein ZK228.8 [Caenorhabditis elegans] emb|CAA16412.1| Hypothetical protein ZK228.8 [Caenorhabditis elegans] ref|NP_507619.1| Serpentine Receptor, class H family member (srh-178) [Caenorhabditis elegans] 8.0E-80
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_507123.1 7 15-37,53-75,95-117,138-160,196-218,239-261,276-298
F57G8.1 7 15-37,53-75,95-117,138-160,196-218,239-261,276-298
GENEFINDER00000042085 6 9-31,51-73,94-116,152-174,195-217,232-254
Sequence
Target Sequence
>C. ELEGANS:177464_AT
aaaaggcaattccttgtatcccgctgaaaatccttagccgacctgatttttctgtcattt
caattaacaattttactttgtgtttttgcattgttactttcttttcaattgttggatttc
aagttttcctcctggtcagtgcaatttgttggaaattatttcatatggtatcccagtcag
aagctacaaaccgtcttcaaaagcaattcttctacgctttatgtctacaggtttttattc
cggtttttgtgctaacttttccaatgatttatgttgttctgacaagttggtttgagtatt
ataatcaagctgcaaccaacactgctctaactataatttctactcacggaattctctcga
ctttgactatgctcattgtgcacacgccttatcgtaaagccgctacggaaatactctgtt
t


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AAAAGGCAATTCCTTGTATCCCGCT 272 131 521 Antisense
ATCCCGCTGAAAATCCTTAGCCGAC 194 39 538 Antisense
GCCGACCTGATTTTTCTGTCATTTC 427 281 557 Antisense
TGGATTTCAAGTTTTCCTCCTGGTC 359 549 633 Antisense
CCTCCTGGTCAGTGCAATTTGTTGG 437 263 648 Antisense
GCAATTCTTCTACGCTTTATGTCTA 329 323 723 Antisense
TCAAGCTGCAACCAACACTGCTCTA 696 631 825 Antisense
ATTTCTACTCACGGAATTCTCTCGA 272 17 856 Antisense
AATTCTCTCGACTTTGACTATGCTC 423 177 870 Antisense
TGCACACGCCTTATCGTAAAGCCGC 70 573 899 Antisense
AAGCCGCTACGGAAATACTCTGTTT 283 149 917 Antisense
Sequence Source Affymetrix Proprietary Database