[Home] | [Total List]

[177421_at]

Description ZK896.3 /REP_DB=WormBase Gene ID /WP=CE15453 /TR=O02346 /GB=CAB05327.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_total > 80      4grp_total > 04      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/177421_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 141
1 2 3 4 range
A 47.3
(0.1)
A
7.9
(-3)
A
8.2
(-3)
A
83.3
(3)
A
75
B 20.2
(-1.1)
A
6.4
(-3)
A
50.8
(3)
A
23.2
(-0.7)
A
44
C 36.4
(-1.7)
A
5.4
(-3)
A
15.8
(-2.6)
A
146.6
(3)
A
141
avr 34.6
(-0.8)
6.6
(-3)
24.9
(-1.6)
84.4
(3)
78

Warning: fopen(./gnuplot/177421_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 80
1 2 3 4 5 6 range
A 33.8
(-0.6)
A
31.5
(-0.9)
A
58.5
(3)
P
17.3
(-3)
A
29.2
(-1.3)
A
47.5
(1.4)
P
41
B 35.9
(-1.8)
A
34.1
(-2.1)
A
26.6
(-3)
A
74
(3)
A
42.7
(-1)
P
31.6
(-2.4)
P
47
C 15.9
(-2.5)
A
72.8
(1.8)
P
28.3
(-1.5)
A
88.8
(3)
A
8.6
(-3)
A
45.5
(-0.2)
P
80
avr 28.5
(-2.7)
46.1
(0.5)
37.8
(-1)
60
(3)
26.8
(-3)
41.5
(-0.3)
33
No Scale

Warning: fopen(./gnuplot/177421_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 23
1 2 3 4 range
A 17.2
(3)
A
1.7
(-3)
A
2.1
(-2.8)
A
12.2
(1.1)
A
16
B 6.4
(-0.2)
A
1.6
(-3)
A
11.8
(3)
A
4.9
(-1.1)
A
10
C 12
(-0.3)
A
1.6
(-3)
A
5.5
(-2)
A
24.7
(3)
A
23
avr 11.9
(2)
1.6
(-3)
6.5
(-0.6)
13.9
(3)
12

Warning: fopen(./gnuplot/177421_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177421_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 19
1 2 3 4 5 6 range
A 6.2
(-1.7)
A
11.2
(1.9)
A
12.7
(3)
P
4.4
(-3)
A
8.8
(0.2)
A
11.6
(2.2)
P
8
B 12.5
(-0.3)
A
11.4
(-0.8)
A
6.5
(-3)
A
19.6
(3)
A
17.4
(2)
P
11.8
(-0.6)
P
13
C 5.9
(-2)
A
22.2
(3)
P
7.2
(-1.6)
A
17.9
(1.7)
A
2.8
(-3)
A
15.2
(0.8)
P
19
avr 8.2
(-3)
14.9
(3)
8.8
(-2.5)
14
(2.2)
9.7
(-1.7)
12.9
(1.2)
7
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177421_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8521
Sequence Type Exemplar sequence
Representative Public ID ZK896.3 NCBI
Target Description ZK896.3 /REP_DB=WormBase Gene ID /WP=CE15453 /TR=O02346 /GB=CAB05327.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070054(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070054 NCBI Caenorhabditis elegans ZK896.3 (ZK896.3) mRNA, complete cds. 11/11 None
SNAP00000024389 ENSEMBL cdna:SNAP chromosome:CEL140:IV:12880637:12885633:-1 11/11 None
GENEFINDER00000024398 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:12883477:12886734:-1 11/11 None
ZK896.3 ENSEMBL cdna:known chromosome:CEL140:IV:12883477:12886097:-1 gene:ZK896.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:12883482-12885797(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl ZK896.3
Entrez Gene 178240 Entrez gene
SwissProt O02346 EMBL-EBI
WormBase CE33913 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAB05327 Hypothetical protein ZK896.3 [Caenorhabditis elegans] ref|NP_502455.2| ZK896.3 [Caenorhabditis elegans] 0.0
blast CAB05319 Hypothetical protein ZK896.4 [Caenorhabditis elegans] ref|NP_502454.1| ZK896.4 [Caenorhabditis elegans] 0.0
blast CAB05327 Hypothetical protein ZK896.3 [Caenorhabditis elegans] ref|NP_502455.2| ZK896.3 [Caenorhabditis elegans] 1.0E-176
blast CAB05320 Hypothetical protein ZK896.5 [Caenorhabditis elegans] ref|NP_502453.1| ZK896.5 [Caenorhabditis elegans] 1.0E-172
blast CAB05319 Hypothetical protein ZK896.4 [Caenorhabditis elegans] ref|NP_502454.1| ZK896.4 [Caenorhabditis elegans] 1.0E-134
blast CAB05320 Hypothetical protein ZK896.5 [Caenorhabditis elegans] ref|NP_502453.1| ZK896.5 [Caenorhabditis elegans] 1.0E-130
Protein Domains
Database ID Description E-Value
Pfam IPR003366 EMBL-EBI Protein of unknown function DUF141 7.2E-40
Pfam IPR003366 EMBL-EBI Protein of unknown function DUF141 1.3E-47
Pfam IPR003366 EMBL-EBI Protein of unknown function DUF141 7.2E-40
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000024398 1 135-157
Sequence
Target Sequence
>C. ELEGANS:177421_AT
aacggaactgttgctgccattttctacactaatttattttttataaaggagcttaccatg
tcgacatcaaatcaactatctgtctataataattttgctacagatgtcaataagcttgct
gattacagctattctaatatcatgggcaggattcctcaaaaattcagtggaaaatttacg
acatttgtactagacaaagacgtagtcatcatgcaatttgtttctactgcttcagctgct
ggctggagctctgcagtcaatggccgtcgaggattctttgcttcaccgaattttggatta
aatgccacgaatcaaaattttgctgatcaagtctgttcatcaaatatgttaaaaatcagt
tacacagttgaaaaagatggaatcgttggacaatcagaattgactcttactattacatcg
aaaaataaggttgttttgaaaaatgtgtacaactcttcaaacttgccaagagctccagtt
catgctctaggagactccatctctgtaaaatatgagtcaaatgattgtatctccacagga
ccatttgtatc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AACGGAACTGTTGCTGCCATTTTCT 573 143 457 Antisense
AAAGGAGCTTACCATGTCGACATCA 200 121 501 Antisense
CAATTTGTTTCTACTGCTTCAGCTG 366 181 670 Antisense
TGGCTGGAGCTCTGCAGTCAATGGC 470 545 696 Antisense
AGTCAATGGCCGTCGAGGATTCTTT 357 61 711 Antisense
GAGGATTCTTTGCTTCACCGAATTT 203 403 725 Antisense
GAATTGACTCTTACTATTACATCGA 693 323 853 Antisense
GTGTACAACTCTTCAAACTTGCCAA 631 483 901 Antisense
CTTGCCAAGAGCTCCAGTTCATGCT 46 219 918 Antisense
GTTCATGCTCTAGGAGACTCCATCT 401 443 934 Antisense
GTATCTCCACAGGACCATTTGTATC 122 455 983 Antisense
Sequence Source Affymetrix Proprietary Database