[Home] | [Total List]

[177246_at]

Description M117.5 /REP_DB=WormBase Gene ID /WP=CE18086 /TR=O62322 /GB=CAA98137.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_total > 95      4grp_total > 01      6grp_total_sub > Increase      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/177246_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 131
1 2 3 4 range
A 23.3
(-1.7)
A
3.3
(-3)
A
35.1
(-1)
A
98.3
(3)
A
95
B 11.7
(-2.4)
A
5.4
(-3)
A
24.9
(-1.2)
A
71.7
(3)
P
66
C 26.5
(-2.1)
A
6.7
(-3)
A
31.1
(-1.9)
A
134.7
(3)
P
128
avr 20.5
(-2)
5.1
(-3)
30.4
(-1.4)
101.6
(3)
97

Warning: fopen(./gnuplot/177246_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 66
1 2 3 4 5 6 range
A 38.1
(-0.4)
M
16.2
(-3)
A
20.2
(-2.5)
A
46.8
(0.6)
A
67.2
(3)
A
58.7
(2)
A
51
B 32.6
(-1.5)
A
48.4
(0.5)
A
21
(-3)
A
67.9
(3)
P
41
(-0.4)
P
53.1
(1.1)
P
47
C 23.9
(0)
A
35.2
(1.6)
A
5.9
(-2.5)
A
1.9
(-3)
A
17.2
(-0.9)
A
45.7
(3)
P
44
avr 31.5
(-0.4)
33.3
(-0.1)
15.7
(-3)
38.9
(0.8)
41.8
(1.3)
52.5
(3)
37
No Scale

Warning: fopen(./gnuplot/177246_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 22
1 2 3 4 range
A 8.5
(0.4)
A
0.7
(-3)
A
9.2
(0.7)
A
14.4
(3)
A
14
B 3.7
(-2)
A
1.3
(-3)
A
5.8
(-1.1)
A
15.3
(3)
P
14
C 8.8
(-1)
A
1.9
(-3)
A
10.8
(-0.4)
A
22.7
(3)
P
21
avr 7
(-0.9)
1.3
(-3)
8.6
(-0.3)
17.5
(3)
16

Warning: fopen(./gnuplot/177246_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177246_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 20
1 2 3 4 5 6 range
A 7
(-2)
M
5.8
(-2.5)
A
4.4
(-3)
A
11.9
(-0.2)
A
20.3
(3)
A
14.3
(0.7)
A
16
B 11.4
(-0.4)
A
16.1
(1.5)
A
5.1
(-3)
A
18
(2.3)
P
16.6
(1.7)
P
19.8
(3)
P
15
C 8.9
(0.4)
A
10.7
(1.1)
A
1.5
(-2.6)
A
0.4
(-3)
A
5.6
(-0.9)
A
15.3
(3)
P
15
avr 9.1
(-0.5)
10.9
(0.4)
3.7
(-3)
10.1
(-0)
14.2
(1.9)
16.5
(3)
13
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177246_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8651
Sequence Type Exemplar sequence
Representative Public ID M117.5 NCBI
Target Description M117.5 /REP_DB=WormBase Gene ID /WP=CE18086 /TR=O62322 /GB=CAA98137.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069836(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069836 NCBI Caenorhabditis elegans M117.5 (M117.5) mRNA, complete cds. 11/11 None
SNAP00000015387 ENSEMBL cdna:SNAP chromosome:CEL140:IV:11829676:11831742:1 11/11 None
M117.5 ENSEMBL cdna:known chromosome:CEL140:IV:11828943:11830416:1 gene:M117.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:11828948-11830422(+) 100.0 100.0
chrIV:11834363-11835994(+) 92.26 92.26
Public Domain and Genome References
Gene Title
Ensembl M117.5
Entrez Gene 187478 Entrez gene
SwissProt O62322 EMBL-EBI
WormBase CE18086 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAA98137 Hypothetical protein M117.5 [Caenorhabditis elegans] ref|NP_502237.1| M117.5 [Caenorhabditis elegans] 0.0
blast CAA98137 Hypothetical protein M117.5 [Caenorhabditis elegans] ref|NP_502237.1| M117.5 [Caenorhabditis elegans] 1.0E-139
blast CAB01176 Hypothetical protein F38H4.2 [Caenorhabditis elegans] ref|NP_502240.1| F38H4.2 [Caenorhabditis elegans] 2.0E-57
blast CAB01176 Hypothetical protein F38H4.2 [Caenorhabditis elegans] ref|NP_502240.1| F38H4.2 [Caenorhabditis elegans] 7.0E-37
blast CAB04877 Hypothetical protein T27E9.8 [Caenorhabditis elegans] ref|NP_499788.1| T27E9.8 [Caenorhabditis elegans] 4.0E-16
blast CAB04877 Hypothetical protein T27E9.8 [Caenorhabditis elegans] ref|NP_499788.1| T27E9.8 [Caenorhabditis elegans] 1.0E-11
Protein Domains
Database ID Description E-Value
Pfam IPR001810 EMBL-EBI Cyclin-like F-box 2.4E-7
Sequence
Target Sequence
>C. ELEGANS:177246_AT
atctacctcagacattttgggaacggaatgtcagtcttatttccttgactactccatatt
caattgttttctgggattatttctataatgaaagcattattgaaaaccagttatccaagg
ttgacaaattacagcttttgcaaaagctgtatctaacctcacaaccaggccacaaaataa
taattcaaaatttcaaattgctcaacgcaagtcagtgttttttgtgcaatatcacattga
acgatttgatactaaataacagtagttttgcatacttggaatatatgaagtttaacgaga
aagacatcagcatttttctaaaacattggattaatggatcaaatgaaagattgattcatt
tgtttttatcaggaaaacccgcatttaatgacagagaattgtccgtcaaaactattctca
aaggaattgattatgagagagcttcatctacccgaacaatgtcacatttgcctagctcat
taaaagattttgttgagtatttcccaaacacactcgaaaatggcttcgacattacaaata
aggagggaactgctgcaacagtcact


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATCTACCTCAGACATTTTGGGAACG 549 23 359 Antisense
GTCAGTCTTATTTCCTTGACTACTC 170 467 388 Antisense
GACTACTCCATATTCAATTGTTTTC 22 373 405 Antisense
AAAGCTGTATCTAACCTCACAACCA 236 125 501 Antisense
TAACCTCACAACCAGGCCACAAAAT 139 639 512 Antisense
GCTCAACGCAAGTCAGTGTTTTTTG 694 301 558 Antisense
AATTGTCCGTCAAAACTATTCTCAA 624 177 755 Antisense
GCTTCATCTACCCGAACAATGTCAC 518 305 799 Antisense
ACAATGTCACATTTGCCTAGCTCAT 77 115 814 Antisense
GAGTATTTCCCAAACACACTCGAAA 457 399 853 Antisense
GGAGGGAACTGCTGCAACAGTCACT 701 515 900 Antisense
Sequence Source Affymetrix Proprietary Database