[Home] | [Total List]

[177177_at]

Description Y73B6BL.H /REP_DB=WormBase Gene ID /WP=CE26281 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAG23467.1
Cluster 6grp_highest_10_10 > 21      6grp_high1_10_10 > 12      4grp_highest_8_8 > 57      4grp_high_8_8 > 34      6grp_highest_nonorm > 50      6grp_total > 23      4grp_total > 46      6grp_highest_sub > De      6grp_high1_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      4grp_rule_based > L1      

Scale

Warning: fopen(./gnuplot/177177_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 648
1 2 3 4 range
A 687.8
(3)
P
657.7
(2.6)
P
375.4
(-1.4)
P
258
(-3)
P
430
B 905.5
(3)
P
480.3
(-1.3)
P
357.3
(-2.6)
P
316.4
(-3)
P
589
C 739.3
(3)
P
453.1
(-1.6)
P
387.7
(-2.6)
P
365.9
(-3)
P
373
avr 777.5
(3)
530.4
(-0.2)
373.5
(-2.2)
313.4
(-3)
464

Warning: fopen(./gnuplot/177177_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 555
1 2 3 4 5 6 range
A 803
(3)
P
566.5
(0.4)
P
515.6
(-0.1)
P
457.4
(-0.7)
P
342.8
(-2)
P
248
(-3)
P
555
B 606.5
(3)
P
589.7
(2.7)
P
524.9
(1.6)
P
450.4
(0.3)
P
320.4
(-1.9)
P
254.1
(-3)
P
352
C 608.5
(3)
P
596
(2.8)
P
543.4
(1.9)
P
513.4
(1.4)
P
251
(-3)
P
310.6
(-2)
P
358
avr 672.7
(3)
584.1
(1.7)
528
(0.8)
473.7
(0)
304.7
(-2.5)
270.9
(-3)
402
No Scale

Warning: fopen(./gnuplot/177177_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 251
1 2 3 4 range
A 250.4
(3)
P
142.8
(-0)
P
98.1
(-1.3)
P
37.8
(-3)
P
213
B 288.8
(3)
P
118.6
(-1.6)
P
82.8
(-2.6)
P
67.4
(-3)
P
221
C 244.7
(3)
P
130.3
(-0.8)
P
135.1
(-0.6)
P
61.7
(-3)
P
183
avr 261.3
(3)
130.6
(-0.8)
105.3
(-1.6)
55.6
(-3)
206

Warning: fopen(./gnuplot/177177_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/177177_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 165
1 2 3 4 5 6 range
A 148
(0.7)
P
201.5
(3)
P
112.3
(-0.8)
P
116
(-0.6)
P
103.4
(-1.2)
P
60.4
(-3)
P
141
B 211
(3)
P
196.3
(2.2)
P
127.5
(-1.3)
P
119.3
(-1.7)
P
130.2
(-1.2)
P
94.8
(-3)
P
116
C 225.5
(3)
P
181.9
(1.2)
P
138.3
(-0.6)
P
103.2
(-2.1)
P
81.2
(-3)
P
104
(-2.1)
P
144
avr 194.8
(3)
193.2
(2.9)
126
(-0.8)
112.8
(-1.5)
104.9
(-2)
86.4
(-3)
108
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 177177_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19375
Sequence Type Exemplar sequence
Representative Public ID Y73B6BL.H NCBI
Target Description Y73B6BL.H /REP_DB=WormBase Gene ID /WP=CE26281 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAG23467.1
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_068576(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_068576 NCBI Caenorhabditis elegans Y73B6BL.21 (Y73B6BL.21) mRNA, complete cds. 11/11 None
GENEFINDER00000032107 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:6396729:6401889:-1 11/11 None
Y73B6BL.21 ENSEMBL cdna:known chromosome:CEL140:IV:6396729:6401889:-1 gene:Y73B6BL.21 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000032053 7/11 Cross Hyb Matching Probes None
SNAP00000032054 2/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:6396734-6401895(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y73B6BL.21
Entrez Gene 177401 Entrez gene
SwissProt Q9GUF5 EMBL-EBI
WormBase CE26281 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE_2:CFAAFFX.14583.1.S1_AT similar to secreted frizzled-related protein 5 cfa
CHICKEN:GGAAFFX.4682.1.S1_AT similar to Secreted frizzled-related sequence protein 5 gga
HG-U133_PLUS_2:207468_S_AT secreted frizzled-related protein 5 hs
HG-U133A_2:207468_S_AT secreted frizzled-related protein 5 hs
HG-U133A:207468_S_AT secreted frizzled-related protein 5 hs
HG-FOCUS:207468_S_AT secreted frizzled-related protein 5 hs
U133_X3P:G8400734_3P_A_AT secreted frizzled-related protein 5 hs
MOE430A:1423023_AT secreted frizzled-related sequence protein 5 mm
MOUSE430_2:1423023_AT secreted frizzled-related sequence protein 5 mm
MOUSE430A_2:1423023_AT secreted frizzled-related sequence protein 5 mm
MOUSE430_2:1436075_AT secreted frizzled-related sequence protein 5 mm
MOE430B:1436075_AT secreted frizzled-related sequence protein 5 mm
MG-U74BV2:105505_AT secreted frizzled-related sequence protein 5 mm
RAE230B:1393069_AT Secreted frizzled-related sequence protein 5 (predicted) rn
RAT230_2:1393069_AT Secreted frizzled-related sequence protein 5 (predicted) rn
RG-U34C:RC_AI231625_AT Secreted frizzled-related sequence protein 5 (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7275 development inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4888 transmembrane receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAG23467 Hypothetical protein Y73B6BL.21 [Caenorhabditis elegans] ref|NP_500977.1| Y73B6BL.21 [Caenorhabditis elegans] 1.0E-154
blast CAE61550 Hypothetical protein CBG05456 [Caenorhabditis briggsae] 1.0E-140
blast XP_695324 PREDICTED: similar to Secreted frizzled-related protein 2 precursor (sFRP-2) (Secreted apoptosis related protein 1) (SARP-1) (SDF5 protein) [Danio rerio] ref|XP_695254.1| PREDICTED: similar to Secreted frizzled-related protein 2 precursor (sFRP-2) (Secreted apoptosis related protein 1) (SARP-1) (SDF5 protein) [Danio rerio] 4.0E-36
Protein Domains
Database ID Description E-Value
Pfam IPR000024 EMBL-EBI Frizzled CRD region 3.0E-39
Sequence
Target Sequence
>C. ELEGANS:177177_AT
ggcgaattacggtttcccatggcctgaaatgctttcttgtgaaaagtttgaagacgatga
tatgtgtataaaaccaatgcagcccgctaaaccaccagcaggtagctccacaacgtgcac
ggcctgctcacaagtcgccacctacgagaatcttgtcgatcaattttgtagatcgcattt
ggtgttaaaagcaaaagtaattcgtgattcaccaacacacattcgtgttcgaaacggaag
aagtttgaaaaaaggagaacgaaggagaggtgtttctgatgttgaaattcgtctttcctc
tgaatcagatggctcatgtccgtgcaatatcccagtaaagaatcaaaatgagaagctgtt
agtaatggcaagtcggcaaccagatggaaaatatttggcaaatttagtattgccgtggca
aaaagaaaaaaatttcaagcgtgcaatccaccagttccagcgactaaactgccagtcttt
aggccgtgaaatccgtgaatcggcttcccggcgtccacattattacgaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGCGAATTACGGTTTCCCATGGCCT 223 491 228 Antisense
ATAAAACCAATGCAGCCCGCTAAAC 240 11 295 Antisense
CTAAACCACCAGCAGGTAGCTCCAC 407 225 314 Antisense
AGTCGCCACCTACGAGAATCTTGTC 655 59 360 Antisense
AAATTCGTCTTTCCTCTGAATCAGA 359 115 512 Antisense
TGAATCAGATGGCTCATGTCCGTGC 688 575 528 Antisense
TCATGTCCGTGCAATATCCCAGTAA 623 621 541 Antisense
TTTCAAGCGTGCAATCCACCAGTTC 295 671 660 Antisense
AAACTGCCAGTCTTTAGGCCGTGAA 103 127 693 Antisense
TGAAATCCGTGAATCGGCTTCCCGG 393 571 714 Antisense
TTCCCGGCGTCCACATTATTACGAA 315 625 732 Antisense
Sequence Source Affymetrix Proprietary Database