[Home] | [Total List]

[176997_at]

Description Y94H6A.J /REP_DB=WormBase Gene ID /WP=CE25637 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAF60896.1
Cluster 6grp_total > 18      4grp_total > 06      6grp_cgc > 11      6grp_cgc_sub > De      6grp_total_sub > Decrease      

Scale

Warning: fopen(./gnuplot/176997_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 53
1 2 3 4 range
A 10.2
(-2.7)
A
9.1
(-3)
A
13.6
(-1.7)
A
30.5
(3)
A
21
B 23.1
(-1.3)
A
8.6
(-2.9)
A
7.8
(-3)
A
60.8
(3)
A
53
C 57.7
(3)
A
10
(-3)
A
37.8
(0.5)
A
49.1
(1.9)
A
48
avr 30.3
(0.4)
9.2
(-3)
19.7
(-1.3)
46.8
(3)
38

Warning: fopen(./gnuplot/176997_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 43
1 2 3 4 5 6 range
A 10
(3)
A
7.6
(0.7)
A
3.8
(-3)
A
4.7
(-2.1)
A
5.5
(-1.4)
A
4.7
(-2.1)
A
6
B 5.5
(0.8)
A
6.7
(3)
A
5.4
(0.6)
A
4
(-1.9)
A
4.5
(-1)
A
3.4
(-3)
A
3
C 46.2
(3)
A
6
(-2.9)
A
15
(-1.6)
A
5.2
(-3)
A
13.2
(-1.8)
A
5.4
(-3)
A
41
avr 20.6
(3)
6.8
(-2.1)
8.1
(-1.7)
4.6
(-3)
7.7
(-1.8)
4.5
(-3)
16
No Scale

Warning: fopen(./gnuplot/176997_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 17
1 2 3 4 range
A 3.7
(1.1)
A
2
(-3)
A
3.5
(0.6)
A
4.5
(3)
A
3
B 7.4
(0)
A
2.1
(-2.8)
A
1.8
(-3)
A
13
(3)
A
11
C 19.1
(3)
A
2.9
(-3)
A
13.2
(0.8)
A
8.3
(-1)
A
16
avr 10.1
(3)
2.3
(-3)
6.2
(0)
8.6
(1.8)
8

Warning: fopen(./gnuplot/176997_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176997_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 16
1 2 3 4 5 6 range
A 1.8
(0.2)
A
2.7
(3)
A
0.8
(-3)
A
1.2
(-1.7)
A
1.7
(-0.2)
A
1.2
(-1.7)
A
2
B 1.9
(1.5)
A
2.2
(3)
A
1.3
(-1.5)
A
1
(-3)
A
1.8
(1)
A
1.3
(-1.5)
A
1
C 17.1
(3)
A
1.8
(-2.7)
A
3.8
(-2)
A
1
(-3)
A
4.3
(-1.8)
A
1.8
(-2.7)
A
16
avr 6.9
(3)
2.2
(-1.9)
2
(-2.1)
1.1
(-3)
2.6
(-1.4)
1.4
(-2.7)
6
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176997_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19378
Sequence Type Exemplar sequence
Representative Public ID Y94H6A.J NCBI
Target Description Y94H6A.J /REP_DB=WormBase Gene ID /WP=CE25637 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAF60896.1
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067849(9)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067849 NCBI Caenorhabditis elegans Y94H6A.1 (Y94H6A.1) mRNA, complete cds. 9/11 None
SNAP00000003287 ENSEMBL cdna:SNAP chromosome:CEL140:IV:2743004:2747374:1 9/11 None
GENEFINDER00000003297 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:2743004:2747374:1 11/11 None
Y94H6A.1 ENSEMBL cdna:known chromosome:CEL140:IV:2743004:2747374:1 gene:Y94H6A.1 9/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:2743009-2747380(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol nhr-277
Ensembl Y94H6A.1
Entrez Gene 190799 Entrez gene
SwissProt Q9N2W3 EMBL-EBI
WormBase CE34619 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3700 transcription factor activity inferred from electronic annotation QuickGO AmiGO
3707 steroid hormone receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF60896 Hypothetical protein Y94H6A.1 [Caenorhabditis elegans] ref|NP_500250.2| Y94H6A.1 [Caenorhabditis elegans] 0.0
blast CAE68227 Hypothetical protein CBG13899 [Caenorhabditis briggsae] 0.0
blast CAE68227 Hypothetical protein CBG13899 [Caenorhabditis briggsae] 1.0E-179
blast CAE68227 Hypothetical protein CBG13899 [Caenorhabditis briggsae] 1.0E-154
blast CAE59975 Hypothetical protein CBG03466 [Caenorhabditis briggsae] 2.0E-21
Protein Domains
Database ID Description E-Value
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 2.1E-8
Pfam IPR001628 EMBL-EBI Zn-finger, C4-type steroid receptor 1.5E-14
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 2.1E-8
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 2.4E-8
Sequence
Target Sequence
>C. ELEGANS:176997_AT
gtccagaagacggccaaatcccggctccgtgctccgcagaatggtttcaagaactttcag
gactgtcatttgaagctcaaactgccgtgcatcgcgcaatttccgagattatggagccca
tggactcgttggacgtcagtatagaggagcttgtgctcatgaagttcataatgatgttca
gtgaaccttcaacccaaacgtccggtgacatctaccgtattcgcagttatcgattaaagt
actgcgagctgctccaaaaatatataaagactcagatacccgacccggaaaggcggattg
ctcgaatcggcgagctgctgaagattgtggaagctgtgaaggtgggagcccgtaacataa
atcatgaatatctacatagaatccgtaccacctcgcaatattttgacaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTCCAGAAGACGGCCAAATCCCGGC 224 477 977 Antisense
TCCGTGCTCCGCAGAATGGTTTCAA 175 593 1002 Antisense
TTGAAGCTCAAACTGCCGTGCATCG 240 703 1046 Antisense
CGTGCATCGCGCAATTTCCGAGATT 486 243 1062 Antisense
TATGGAGCCCATGGACTCGTTGGAC 236 655 1086 Antisense
TTCAACCCAAACGTCCGGTGACATC 360 673 1164 Antisense
GTGACATCTACCGTATTCGCAGTTA 212 483 1181 Antisense
ATTAAAGTACTGCGAGCTGCTCCAA 34 13 1209 Antisense
AAAGGCGGATTGCTCGAATCGGCGA 487 113 1265 Antisense
ATCTACATAGAATCCGTACCACCTC 218 33 1346 Antisense
GTACCACCTCGCAATATTTTGACAA 9 459 1361 Antisense
Sequence Source Affymetrix Proprietary Database