[Home] | [Total List]

[176817_at]

Description Y46H3D.4 /REP_DB=WormBase Gene ID /WP=CE24321 /GB=AAK72307.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 02      4grp_total > 02      

Scale

Warning: fopen(./gnuplot/176817_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 115
1 2 3 4 range
A 1.6
(-2.6)
A
8.2
(3)
A
1.1
(-3)
A
3.7
(-0.8)
A
7
B 6.1
(-2.7)
A
3.4
(-3)
A
3.9
(-2.9)
A
57.5
(3)
A
54
C 6.2
(-2.7)
A
3.1
(-2.9)
A
1.2
(-3)
A
116.5
(3)
A
115
avr 4.6
(-2.7)
4.9
(-2.7)
2.1
(-3)
59.2
(3)
57

Warning: fopen(./gnuplot/176817_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 32
1 2 3 4 5 6 range
A 30.6
(3)
A
25.9
(1.9)
A
11.5
(-1.4)
A
5.9
(-2.7)
A
4.8
(-3)
A
4.9
(-3)
A
26
B 2.5
(-2.2)
A
5.5
(0.7)
A
7.8
(3)
A
5.5
(0.7)
A
5.9
(1.1)
A
1.7
(-3)
A
6
C 3
(-2.6)
A
25.2
(1.6)
A
1.1
(-3)
A
32.8
(3)
A
4.1
(-2.4)
A
4.5
(-2.4)
A
32
avr 12
(0.3)
18.9
(3)
6.8
(-1.8)
14.7
(1.3)
4.9
(-2.5)
3.7
(-3)
15
No Scale

Warning: fopen(./gnuplot/176817_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 19
1 2 3 4 range
A 0.6
(-1.8)
A
1.8
(3)
A
0.3
(-3)
A
0.5
(-2.2)
A
2
B 2
(-2.4)
A
0.8
(-3)
A
0.9
(-2.9)
A
12.3
(3)
A
12
C 2
(-2.5)
A
0.9
(-2.8)
A
0.4
(-3)
A
19.6
(3)
A
19
avr 1.5
(-2.4)
1.2
(-2.6)
0.5
(-3)
10.8
(3)
10

Warning: fopen(./gnuplot/176817_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176817_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 9
1 2 3 4 5 6 range
A 5.6
(0.3)
A
9.2
(3)
A
2.5
(-2)
A
1.5
(-2.8)
A
1.5
(-2.8)
A
1.2
(-3)
A
8
B 0.9
(-2)
A
1.8
(1)
A
1.9
(1.3)
A
1.5
(0)
A
2.4
(3)
A
0.6
(-3)
A
2
C 1.1
(-2.4)
A
7.7
(3)
A
0.3
(-3)
A
6.6
(2.1)
A
1.3
(-2.2)
A
1.5
(-2)
A
7
avr 2.5
(-1.4)
6.2
(3)
1.6
(-2.4)
3.2
(-0.5)
1.7
(-2.3)
1.1
(-3)
5
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176817_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15609
Sequence Type Exemplar sequence
Representative Public ID Y46H3D.4 NCBI
Target Description Y46H3D.4 /REP_DB=WormBase Gene ID /WP=CE24321 /GB=AAK72307.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071062(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071062 NCBI Caenorhabditis elegans Y46H3D.4 (Y46H3D.4) mRNA, complete cds. 11/11 None
Y46H3D.4 ENSEMBL cdna:known chromosome:CEL140:V:1631846:1635848:1 gene:Y46H3D.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000018928 2/11 Cross Hyb Matching Probes None
GENEFINDER00000018941 4/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:1631845-1635848(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y46H3D.4
Entrez Gene 189969 Entrez gene
SwissProt Q966B5 EMBL-EBI
WormBase CE24321 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4714 transmembrane receptor protein tyrosine kinase activity inferred from electronic annotation QuickGO AmiGO
5006 epidermal growth factor receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_503463 Y46H3D.4 [Caenorhabditis elegans] gb|AAK72307.1| Hypothetical protein Y46H3D.4 [Caenorhabditis elegans] 0.0
blast CAE65518 Hypothetical protein CBG10492 [Caenorhabditis briggsae] 2.0E-77
blast CAE63053 Hypothetical protein CBG07326 [Caenorhabditis briggsae] 1.0E-64
Protein Domains
Database ID Description E-Value
Pfam IPR000494 EMBL-EBI Epidermal growth-factor receptor (EGFR), L domain 7.5E-15
Pfam IPR000494 EMBL-EBI Epidermal growth-factor receptor (EGFR), L domain 1.7E-17
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_503463.1 1 480-502
Y46H3D.4 1 480-502
Sequence
Target Sequence
>C. ELEGANS:176817_AT
ggacggcgaagacgattgtattttcgatggaatgagcaaacttgataacaattgcagcga
tgtattagggaaaataacgataggctctggagatgaagcatatgttgaaaaactgagaaa
tgtgaaaaatatctatggaggaataaggattgagaacacgaacttgacaaacttggagtt
tttggggagtttggaatatgttgcaagcttgaatgattctgccgttccttttcaaataag
ctcaaacaagcttctacagaatgccagcttacccaatttgaagcgagtattttccacaag
cagatatcaaatcggatttcaagagaatggaaatgattttctcaactcgactgcttgtct
tttccttatgaatcaattatttttgacaaacgttgtttttgatggaaatgagtgtgaagc
cattgacagaaccaatcagaacaatggtgccaattggattttcagattgaatttttttat
tttattttcaaataattcaattttgattttttttattttgaaagttttcgttatttttta
ttctgaacacagctttctt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGACGGCGAAGACGATTGTATTTTC 264 523 978 Antisense
GAGAACACGAACTTGACAAACTTGG 115 391 1129 Antisense
AGCTTGAATGATTCTGCCGTTCCTT 207 79 1183 Antisense
GTTCCTTTTCAAATAAGCTCAAACA 427 441 1201 Antisense
GCTTCTACAGAATGCCAGCTTACCC 608 305 1227 Antisense
GAATGCCAGCTTACCCAATTTGAAG 123 331 1236 Antisense
AAGCGAGTATTTTCCACAAGCAGAT 648 149 1258 Antisense
AATGATTTTCTCAACTCGACTGCTT 147 165 1309 Antisense
TCGACTGCTTGTCTTTTCCTTATGA 536 601 1324 Antisense
GAGTGTGAAGCCATTGACAGAACCA 117 401 1387 Antisense
TTTTTATTCTGAACACAGCTTTCTT 341 675 1512 Antisense
Sequence Source Affymetrix Proprietary Database