[Home] | [Total List]

[176791_at]

Description Y49C4A.9 /REP_DB=WormBase Gene ID /WP=CE22218 /GB=AAK72319.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 50      4grp_total > 14      6grp_cgc > 94      6grp_cgc_sub > 04      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/176791_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 77
1 2 3 4 range
A 14.3
(-2.1)
A
5.5
(-3)
A
9.9
(-2.5)
A
61.8
(3)
A
56
B 75.1
(3)
A
11.8
(-3)
A
13.6
(-2.8)
A
15.4
(-2.7)
A
63
C 34.2
(-1.2)
A
38.9
(-0.8)
A
13.2
(-3)
A
82.6
(3)
A
69
avr 41.2
(1.2)
18.7
(-2.1)
12.2
(-3)
53.3
(3)
41

Warning: fopen(./gnuplot/176791_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 48
1 2 3 4 5 6 range
A 33.8
(3)
A
6.2
(-3)
A
8.7
(-2.5)
A
16.8
(-0.7)
A
10
(-2.2)
A
12.6
(-1.6)
A
28
B 11
(-1.1)
A
24.6
(2.9)
A
9.8
(-1.5)
A
25.1
(3)
A
10.2
(-1.4)
A
4.6
(-3)
A
21
C 7.6
(-2.5)
A
10.6
(-2.2)
A
52
(3)
A
34
(0.8)
A
9.2
(-2.3)
A
3.8
(-3)
A
48
avr 17.5
(0.4)
13.8
(-0.8)
23.5
(2.4)
25.3
(3)
9.8
(-2.1)
7
(-3)
18
No Scale

Warning: fopen(./gnuplot/176791_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 23
1 2 3 4 range
A 5.2
(0.1)
A
1.2
(-3)
A
2.6
(-1.9)
A
9
(3)
A
8
B 24
(3)
A
2.9
(-3)
A
3.2
(-2.9)
A
3.3
(-2.9)
A
21
C 11.3
(1.3)
A
11.2
(1.3)
A
4.6
(-3)
A
13.9
(3)
A
9
avr 13.5
(3)
5.1
(-2)
3.5
(-3)
8.7
(0.1)
10

Warning: fopen(./gnuplot/176791_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176791_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12
1 2 3 4 5 6 range
A 6.2
(3)
A
2.2
(-2.6)
A
1.9
(-3)
A
4.3
(0.3)
A
3
(-1.5)
A
3.1
(-1.3)
A
4
B 3.8
(-1.1)
A
8.2
(3)
A
2.4
(-2.4)
A
6.6
(1.5)
A
4.2
(-0.7)
A
1.7
(-3)
A
6
C 2.8
(-2.2)
A
3.2
(-2)
A
13.2
(3)
A
6.8
(-0.2)
A
3
(-2.1)
A
1.3
(-3)
A
12
avr 4.3
(0.5)
4.5
(0.8)
5.8
(2.8)
5.9
(3)
3.4
(-0.8)
2
(-3)
4
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176791_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14996
Sequence Type Exemplar sequence
Representative Public ID Y49C4A.9 NCBI
Target Description Y49C4A.9 /REP_DB=WormBase Gene ID /WP=CE22218 /GB=AAK72319.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070902(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070902 NCBI Caenorhabditis elegans CYtochrome P450 family member (cyp-33C11) (cyp-33C11) mRNA, complete cds. 11/11 None
SNAP00000005335 ENSEMBL cdna:SNAP chromosome:CEL140:V:710472:712508:-1 11/11 None
GENEFINDER00000005336 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:710472:712751:-1 11/11 None
Y49C4A.9 ENSEMBL cdna:known chromosome:CEL140:V:710472:712751:-1 gene:Y49C4A.9 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:710471-712751(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol cyp-33C11
Ensembl Y49C4A.9
Entrez Gene 190065 Entrez gene
SwissProt Q965T7 EMBL-EBI
WormBase CE22218 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:257632_AT cytochrome P450 71B21, putative (CYP71B21) at
HG-U133_PLUS_2:216025_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:216025_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:216025_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U95AV2:1455_F_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HC-G110:1455_F_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133_PLUS_2:220017_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:220017_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:220017_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HU35KSUBA:L16883_S_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HUGENEFL:M61855_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133_PLUS_2:217558_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:217558_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:217558_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:G13699817_3P_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:G13699817_3P_A_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.282639.0.S1_3P_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.3.S1_3P_A_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.2.S1_3P_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.2.S1_3P_A_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.1.S1_3P_A_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:220017_3P_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:214421_3P_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:214421_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133_PLUS_2:214421_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:214421_X_AT cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133_PLUS_2:216661_X_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:216661_X_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:216661_X_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.3.S1_3P_X_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133_PLUS_2:214419_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:214419_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-FOCUS:214419_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:214419_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A_2:214420_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133_PLUS_2:214420_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
HG-U133A:214420_S_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.1.A1_3P_A_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
U133_X3P:HS.167529.1.A2_3P_A_AT Cytochrome P450, family 2, subfamily C, polypeptide 9 hs
MU11KSUBA:D17674_S_AT cytochrome P450, family 2, subfamily c, polypeptide 29 mm
MOE430A:1417651_AT cytochrome P450, family 2, subfamily c, polypeptide 29 mm
MOUSE430A_2:1417651_AT cytochrome P450, family 2, subfamily c, polypeptide 29 mm
MOUSE430_2:1417651_AT cytochrome P450, family 2, subfamily c, polypeptide 29 mm
MG-U74AV2:93585_AT cytochrome P450, family 2, subfamily c, polypeptide 29 mm
RT-U34:M24239CDS#2_F_AT Cytochrome P450, subfamily IIC6 rn
RG-U34A:M24239CDS#2_F_AT Cytochrome P450, subfamily IIC6 rn
RT-U34:RC_AA945571_S_AT Cytochrome P450, subfamily IIC6 rn
RG-U34A:RC_AA945571_S_AT Cytochrome P450, subfamily IIC6 rn
RG-U34A:M14776_F_AT Cytochrome P450, subfamily IIC6 rn
RAE230A:1370580_A_AT Cytochrome P450, subfamily IIC6 rn
RAT230_2:1370580_A_AT Cytochrome P450, subfamily IIC6 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6118 electron transport inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4497 monooxygenase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_503303 CYtochrome P450 family member (cyp-33C11) [Caenorhabditis elegans] gb|AAK72319.1| Cytochrome p450 family protein 33C11 [Caenorhabditis elegans] 0.0
blast CAE62278 Hypothetical protein CBG06337 [Caenorhabditis briggsae] 0.0
blast CAE62278 Hypothetical protein CBG06337 [Caenorhabditis briggsae] 1.0E-176
blast AAG24101 Cytochrome p450 family protein 33C5 [Caenorhabditis elegans] ref|NP_503616.1| CYtochrome P450 family member (cyp-33C5) [Caenorhabditis elegans] 1.0E-172
Protein Families
Method ID Description E-Value
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-137
p450 CP1B_MOUSE Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 1.0E-162
Protein Domains
Database ID Description E-Value
Pfam IPR001128 EMBL-EBI Cytochrome P450 7.2E-110
Pfam IPR001128 EMBL-EBI Cytochrome P450 2.1E-95
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_503303.1 1 2-20
Y49C4A.9 1 2-20
GENEFINDER00000005336 1 2-20
Sequence
Target Sequence
>C. ELEGANS:176791_AT
gtgctttgacttgtggtttgctgggctcaccacaactaacactacaataaattggacaat
aagctatgttttgaaccacccggaagttcaagataagatgcaagaggagctggataaggt
ggtgggaagtgatagattggtgacaatatctgataaaagcagccttccgtacatgaatgc
ggtgatcaatgagtctcagagatgtgtaaatttacttccctgcaatttgtttcacgcaac
tactagggatactgtaattaatggaaatataattccaaaaggaacaggtgttattgccca
gattagtacagttatgctggatgagaagatcttccccgacccctataaattccaacctga
aagattcatagatgaaaatggagcactgaaaaagatcgagcagctaatcccattttcagt
cggaaaacggcagtgcctcggtgaagggctagctcggatggagcttttcctgattgtcgc
caatctattcaatcgatattttatcacaccatccagtgctggacctccatcattggag


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTGCTTTGACTTGTGGTTTGCTGGG 577 477 897 Antisense
TTTGCTGGGCTCACCACAACTAACA 179 667 913 Antisense
AGCTATGTTTTGAACCACCCGGAAG 377 75 958 Antisense
AAGCAGCCTTCCGTACATGAATGCG 42 151 1053 Antisense
TACTTCCCTGCAATTTGTTTCACGC 172 645 1109 Antisense
GAACAGGTGTTATTGCCCAGATTAG 531 351 1178 Antisense
GCAGCTAATCCCATTTTCAGTCGGA 45 297 1296 Antisense
AGTGCCTCGGTGAAGGGCTAGCTCG 184 61 1328 Antisense
GATGGAGCTTTTCCTGATTGTCGCC 285 407 1353 Antisense
TTTATCACACCATCCAGTGCTGGAC 111 675 1396 Antisense
CAGTGCTGGACCTCCATCATTGGAG 481 205 1410 Antisense
Sequence Source Affymetrix Proprietary Database