[Home] | [Total List]

[176767_at]

Description Y92C3A.2 /REP_DB=WormBase Gene ID /WP=CE26309 /GB=AAK31570.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Cluster 6grp_total > 03      4grp_total > 34      

Scale

Warning: fopen(./gnuplot/176767_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 24
1 2 3 4 range
A 3
(-3)
A
22.5
(2)
A
15.4
(0.2)
A
26.5
(3)
A
24
B 2.2
(-3)
A
21
(3)
A
4.9
(-2.1)
A
5.8
(-1.9)
A
19
C 5.3
(-3)
A
18.5
(3)
A
14.3
(1.1)
A
17
(2.3)
A
13
avr 3.5
(-3)
20.7
(3)
11.5
(-0.2)
16.4
(1.5)
17

Warning: fopen(./gnuplot/176767_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 13
1 2 3 4 5 6 range
A 10
(0.8)
A
13.9
(3)
A
5.8
(-1.6)
A
7.1
(-0.9)
A
3.4
(-3)
A
4.7
(-2.3)
A
11
B 2.9
(-2.1)
A
5.8
(3)
A
5.7
(2.8)
A
4.5
(0.7)
A
4
(-0.2)
A
2.4
(-3)
A
3
C 6.6
(0.8)
A
6
(0.4)
A
6.3
(0.6)
A
9.6
(3)
A
4.6
(-0.6)
A
1.3
(-3)
A
8
avr 6.5
(0.8)
8.6
(3)
5.9
(0.2)
7.1
(1.4)
4
(-1.8)
2.8
(-3)
6
No Scale

Warning: fopen(./gnuplot/176767_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5
1 2 3 4 range
A 1.1
(-3)
A
4.9
(3)
A
4
(1.6)
A
3.9
(1.4)
A
4
B 0.7
(-3)
A
5.2
(3)
A
1.1
(-2.5)
A
1.2
(-2.3)
A
5
C 1.8
(-3)
A
5.3
(3)
A
5
(2.5)
A
2.9
(-1.1)
A
4
avr 1.2
(-3)
5.1
(3)
3.4
(0.4)
2.7
(-0.7)
4

Warning: fopen(./gnuplot/176767_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176767_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5
1 2 3 4 5 6 range
A 1.8
(-1.8)
A
4.9
(3)
A
1.3
(-2.5)
A
1.8
(-1.8)
A
1
(-3)
A
1.1
(-2.8)
A
4
B 1
(-2.4)
A
1.9
(3)
A
1.4
(-0)
A
1.2
(-1.2)
A
1.6
(1.2)
A
0.9
(-3)
A
1
C 2.4
(3)
A
1.8
(1.2)
A
1.6
(0.6)
A
1.9
(1.5)
A
1.5
(0.3)
A
0.4
(-3)
A
2
avr 1.7
(-0.4)
2.9
(3)
1.4
(-1.3)
1.6
(-0.7)
1.4
(-1.3)
0.8
(-3)
2
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176767_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8238
Sequence Type Exemplar sequence
Representative Public ID Y92C3A.2 NCBI
Target Description Y92C3A.2 /REP_DB=WormBase Gene ID /WP=CE26309 /GB=AAK31570.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064939(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_064939 NCBI Caenorhabditis elegans Y71D11A.1 (Y71D11A.1) mRNA, complete cds. 10/11 None
SNAP00000001514 ENSEMBL cdna:SNAP chromosome:CEL140:III:1156999:1160797:1 10/11 None
GENEFINDER00000001520 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:1156999:1160792:1 10/11 None
Y71D11A.1 ENSEMBL cdna:known chromosome:CEL140:III:1152032:1180880:1 gene:Y71D11A.1 10/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:1156998-1160550(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y71D11A.1
Entrez Gene 190583 Entrez gene
WormBase CE38125 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6810 transport inferred from electronic annotation QuickGO AmiGO
7156 homophilic cell adhesion inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
30288 periplasmic space (sensu Gram-negative Bacteria) inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5215 transporter activity inferred from electronic annotation QuickGO AmiGO
5509 calcium ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_497340 Y71D11A.1 [Caenorhabditis elegans] 0.0
blast CAE66457 Hypothetical protein CBG11734 [Caenorhabditis briggsae] 0.0
blast ABA00154 Hypothetical protein Y71D11A.1 [Caenorhabditis elegans] 0.0
blast CAE66456 Hypothetical protein CBG11733 [Caenorhabditis briggsae] 5.0E-69
Protein Domains
Database ID Description E-Value
Pfam IPR002126 EMBL-EBI Cadherin 6.8E-9
Pfam IPR002126 EMBL-EBI Cadherin 6.8E-9
Pfam IPR002126 EMBL-EBI Cadherin 5.2E-5
Pfam IPR002126 EMBL-EBI Cadherin 3.2E-21
Pfam IPR002126 EMBL-EBI Cadherin 2.5E-6
Pfam IPR002126 EMBL-EBI Cadherin 1.3E-6
Pfam IPR002126 EMBL-EBI Cadherin 8.8E-14
Pfam IPR002126 EMBL-EBI Cadherin 2.5E-4
Pfam IPR002126 EMBL-EBI Cadherin 1.8E-6
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_497340.2 1 2774-2796
Y71D11A.1 1 2774-2796
Sequence
Target Sequence
>C. ELEGANS:176767_AT
atgggcggagccacaatccagaaagtgggcggagtcaaacaagagaatgtgaagacaatt
ctcaaggcgcccgagacaggagaatctgaaaatttggaaaatctcgaagattctgaagac
gtggaagtggtgacggtcattgaggaggtcgaggtggaagaggacgatgacgtcatcgag
gatcacgtggaaaatgttgaaaatgacgtcagaactactaccgcttcgatgtctagaacg
gtagatcaccaacgaacaacgacagaagaaccggaagctaataccgtggaagaggagccc
ccggcaccaacaactacagtattctcattcccccaacccgaatacacgtatgacgctttt
ggtatggaaatccaggagaatgacgtcatcgggaaagtcgcggcgggaccgagaaccgag
ttttacgcggttgatagggagatgatcggcctaatcaaaatcaatgaagccggtgagctt
ctcgccggcaagaagctcaaccgccataaggatggaccattgaaattcggagtttctgca
acaaatggctttgagacgcgggctggt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGGGCGGAGCCACAATCCAGAAAG 365 49 985 Antisense
TCAAGGCGCCCGAGACAGGAGAATC 493 629 1046 Antisense
AATGACGTCAGAACTACTACCGCTT 171 165 1186 Antisense
TACTACCGCTTCGATGTCTAGAACG 393 645 1200 Antisense
CGGTAGATCACCAACGAACAACGAC 99 243 1223 Antisense
AACAACTACAGTATTCTCATTCCCC 36 135 1293 Antisense
TCCCCCAACCCGAATACACGTATGA 230 597 1313 Antisense
ACACGTATGACGCTTTTGGTATGGA 680 101 1328 Antisense
GTCATCGGGAAAGTCGCGGCGGGAC 367 467 1369 Antisense
GCAAGAAGCTCAACCGCCATAAGGA 323 321 1472 Antisense
AAATGGCTTTGAGACGCGGGCTGGT 626 119 1527 Antisense
Sequence Source Affymetrix Proprietary Database