[Home] | [Total List]

[176760_at]

Description F18E3.10 /REP_DB=WormBase Gene ID /WP=CE17683 /GB=AAK18935.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 02      4grp_total > 18      

Scale

Warning: fopen(./gnuplot/176760_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 90
1 2 3 4 range
A 37.5
(-3)
A
62.6
(-0.8)
P
73.4
(0.2)
A
105.8
(3)
P
68
B 43.9
(-1.7)
P
75.9
(2.4)
A
33.4
(-3)
A
81
(3)
A
48
C 75.8
(-0.8)
P
61.6
(-1.9)
P
47.9
(-3)
A
123
(3)
P
75
avr 52.4
(-2.9)
66.7
(-1.2)
51.6
(-3)
103.3
(3)
52

Warning: fopen(./gnuplot/176760_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 77
1 2 3 4 5 6 range
A 60.3
(1.5)
A
21.9
(-2.3)
A
60.1
(1.5)
P
14.4
(-3)
A
75.1
(3)
P
30
(-1.5)
A
61
B 53.4
(-0.3)
A
73.5
(1.5)
P
44.7
(-1.1)
A
23.6
(-3)
A
90.5
(3)
P
34.2
(-2)
A
67
C 48.3
(0.1)
P
80.6
(3)
P
41.2
(-0.5)
A
61.6
(1.3)
A
13.3
(-3)
A
30.6
(-1.5)
A
67
avr 54
(1.8)
58.7
(2.8)
48.7
(0.7)
33.2
(-2.7)
59.6
(3)
31.6
(-3)
28
No Scale

Warning: fopen(./gnuplot/176760_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 17
1 2 3 4 range
A 13.7
(-2.9)
A
13.6
(-3)
P
19.2
(3)
A
15.5
(-1)
P
6
B 14
(0.4)
P
18.7
(3)
A
7.7
(-3)
A
17.3
(2.2)
A
11
C 25.1
(3)
P
17.7
(-2.3)
P
16.7
(-3)
A
20.7
(-0.1)
P
8
avr 17.6
(2.6)
16.7
(1)
14.5
(-3)
17.8
(3)
3

Warning: fopen(./gnuplot/176760_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176760_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 33
1 2 3 4 5 6 range
A 11.1
(-0.6)
A
7.8
(-1.7)
A
13.1
(-0)
P
3.6
(-3)
A
22.7
(3)
P
7.3
(-1.8)
A
19
B 18.6
(-0.6)
A
24.5
(0.6)
P
10.9
(-2.1)
A
6.2
(-3)
A
36.8
(3)
P
12.8
(-1.7)
A
31
C 17.9
(1)
P
24.6
(3)
P
10.5
(-1.2)
A
12.4
(-0.6)
A
4.3
(-3)
A
10.2
(-1.3)
A
20
avr 15.9
(0.7)
19
(2)
11.5
(-1.2)
7.4
(-3)
21.3
(3)
10.1
(-1.8)
14
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176760_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.11404
Sequence Type Exemplar sequence
Representative Public ID F18E3.10 NCBI
Target Description F18E3.10 /REP_DB=WormBase Gene ID /WP=CE17683 /GB=AAK18935.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072502(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072502 NCBI Caenorhabditis elegans F18E3.10 (F18E3.10) mRNA, complete cds. 11/11 None
F18E3.10 ENSEMBL cdna:known chromosome:CEL140:V:7426165:7427170:-1 gene:F18E3.10 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000036721 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:7426165-7427171(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F18E3.10
Entrez Gene 184645 Entrez gene
SwissProt Q9BI94 EMBL-EBI
WormBase CE17683 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4930 G-protein coupled receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_504903 F18E3.10 [Caenorhabditis elegans] gb|AAK18935.1| Hypothetical protein F18E3.10 [Caenorhabditis elegans] 1.0E-137
blast T29215 hypothetical protein F18E3.3 - Caenorhabditis elegans 9.0E-25
blast CAB05795 Hypothetical protein T08G3.5 [Caenorhabditis elegans] ref|NP_507159.1| Serpentine Receptor, class H family member (srh-141) [Caenorhabditis elegans] 2.0E-16
Protein Domains
Database ID Description E-Value
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 2.3E-30
Pfam IPR003003 EMBL-EBI 7TM chemoreceptor, subfamily 2 2.0E-19
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504903.1 4 20-42,72-94,115-137,171-188
F18E3.10 4 20-42,72-94,115-137,171-188
Sequence
Target Sequence
>C. ELEGANS:176760_AT
cacttcacattctcggagcttacctaatattctttcacaccccatcatctatgaaaaatg
caaaaaaacaacattatgctacttcatgtctcttgttcaatcatggatattttcatcacg
agcggcttcgggttttctatatggattccgtccccggctgggttcccgccgcgattttct
catacgttgcactctttgaatcacgttacaacaacctggtgagacacgacaaatctgaat
ttactcgatttttgagagcgctattttatttgacaaatattgtctttttacaaggttgta
tgatttttattttttggcatatgccaactcagaaagaggggaggatgaatgtgaaaaagg
atcatccctgcattccactgtcatacgtagaaaatcccaacttcttgcacctgaattccc
caacatccgatacagttctggtcacagtttttttgatggtatctatgataaattggtaca
agaaccgtgtcagtcagcactcgaaagttccagacaaagtttttcaccgcatcgcttctt
caaatggcgataccgtcggtttccttcgcgctcccaataatggcttat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CACTTCACATTCTCGGAGCTTACCT 108 197 98 Antisense
GCTTACCTAATATTCTTTCACACCC 407 305 115 Antisense
GCTACTTCATGTCTCTTGTTCAATC 221 303 175 Antisense
GATATTTTCATCACGAGCGGCTTCG 200 427 203 Antisense
TTTTCTCATACGTTGCACTCTTTGA 279 677 272 Antisense
AAAAAGGATCATCCCTGCATTCCAC 17 131 451 Antisense
TTCCCCAACATCCGATACAGTTCTG 209 699 513 Antisense
CAAGAACCGTGTCAGTCAGCACTCG 659 183 576 Antisense
CCAGACAAAGTTTTTCACCGCATCG 377 273 607 Antisense
CACCGCATCGCTTCTTCAAATGGCG 652 199 622 Antisense
CTTCGCGCTCCCAATAATGGCTTAT 469 219 661 Antisense
Sequence Source Affymetrix Proprietary Database