[Home] | [Total List]

[176603_at] 7TM chemoreceptor, srg family

Description T12A2.13 /REP_DB=WormBase Gene ID /WP=CE07482 /GEN=srg-6 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Cluster 6grp_total > 51      4grp_total > 19      6grp_cgc > 83      6grp_cgc_sub > 03      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/176603_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 83
1 2 3 4 range
A 17.6
(-1)
A
23.8
(-0)
A
5.5
(-3)
A
42.5
(3)
P
37
B 27.6
(-2)
A
48.2
(3)
A
30
(-1.4)
A
23.3
(-3)
A
25
C 25.5
(-2.4)
A
32.4
(-1.8)
A
18.1
(-3)
A
88.5
(3)
M
70
avr 23.6
(-2)
34.8
(0)
17.9
(-3)
51.4
(3)
34

Warning: fopen(./gnuplot/176603_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 51
1 2 3 4 5 6 range
A 17.7
(-1.2)
A
4.4
(-2.8)
A
52.6
(3)
A
23.2
(-0.5)
A
13.4
(-1.7)
A
2.5
(-3)
A
50
B 25.4
(-0.4)
A
9.2
(-2.7)
A
48.8
(3)
A
28.9
(0.1)
A
7.1
(-3)
A
7.6
(-2.9)
A
42
C 10.6
(-1.5)
A
38
(3)
A
5.1
(-2.4)
A
34.8
(2.5)
A
12.1
(-1.3)
A
1.7
(-3)
A
36
avr 17.9
(-0.3)
17.2
(-0.5)
35.5
(3)
29
(1.8)
10.9
(-1.7)
3.9
(-3)
32
No Scale

Warning: fopen(./gnuplot/176603_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 14
1 2 3 4 range
A 6.4
(3)
A
5.2
(1.6)
A
1.4
(-3)
A
6.2
(2.8)
P
5
B 8.8
(0.3)
A
11.9
(3)
A
7
(-1.3)
A
5
(-3)
A
7
C 8.4
(-1.5)
A
9.3
(-0.9)
A
6.3
(-3)
A
14.9
(3)
M
9
avr 7.9
(1.6)
8.8
(3)
4.9
(-3)
8.7
(2.8)
4

Warning: fopen(./gnuplot/176603_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176603_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 11
1 2 3 4 5 6 range
A 3.3
(-1.5)
A
1.6
(-2.4)
A
11.4
(3)
A
5.9
(-0.1)
A
4
(-1.1)
A
0.6
(-3)
A
11
B 8.8
(1)
A
3.1
(-2.8)
A
11.8
(3)
A
7.7
(0.3)
A
2.9
(-2.9)
A
2.8
(-3)
A
9
C 3.9
(-1.2)
A
11.6
(3)
A
1.3
(-2.6)
A
7
(0.5)
A
3.9
(-1.2)
A
0.6
(-3)
A
11
avr 5.3
(0.5)
5.4
(0.6)
8.2
(3)
6.9
(1.9)
3.6
(-1)
1.3
(-3)
7
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176603_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.6930
Sequence Type Exemplar sequence
Representative Public ID T12A2.13 NCBI
Target Description T12A2.13 /REP_DB=WormBase Gene ID /WP=CE07482 /GEN=srg-6 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_065969(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_065969 NCBI Caenorhabditis elegans Serpentine Receptor, class G (gamma) family member (srg-6) (srg-6) mRNA, complete cds. 11/11 None
T12A2.13 ENSEMBL cdna:known chromosome:CEL140:III:6264399:6265950:-1 gene:T12A2.13 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:6264397-6265949(-) 100.0 100.0
Public Domain and Genome References
Gene Title 7TM chemoreceptor, srg family
Gene Symbol srg-6
Ensembl T12A2.13
Entrez Gene 191832 Entrez gene
SwissProt P54128 EMBL-EBI
WormBase CE07482 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7165 signal transduction inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4888 transmembrane receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK84569 Serpentine receptor, class g (gamma) protein 6 [Caenorhabditis elegans] ref|NP_498370.1| Serpentine Receptor, class G (gamma) family member (srg-6) [Caenorhabditis elegans] sp|P54128|SRG6_CAEEL Serpentine receptor class gamma-6 (Protein srg-6) 0.0
blast 2123261AF chemosensory receptor 1.0E-180
blast CAE70739 Hypothetical protein CBG17484 [Caenorhabditis briggsae] 3.0E-44
Protein Domains
Database ID Description E-Value
Pfam IPR000609 EMBL-EBI Integral membrane protein Srg, nematode type 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_498370.1 7 23-45,58-80,95-117,146-168,198-220,233-255,265-287
T12A2.13 7 23-45,58-80,95-117,146-168,198-220,233-255,265-287
Sequence
Target Sequence
>C. ELEGANS:176603_AT
atcgacataacatatcctctttggttctattttcatgtgggtaaaatggttgctcaaatg
agcatcagttttgagagaatgactttcaacctattaaaaccaaatgactatcgaagaata
tggaaacatggattaacagcttgtgtgataatgataatatttgttccgtttagtataatt
tggaatattctgatatcagacaaatatatacagttttattttggaggatttcaaccgaat
tattcaagaagagtgaattggtttggcactaccgcatggcaactaacctatatgcaaata
tcaatggcagtcacacttctgtcaaacattgtcacaggagcaattctctggaaatctcaa
aaccagagtcgaaaatcgagactcttgtgcagaatttggtttgcaatttcaacggaatac
ttattaagtgcctgcgcattttgttacttgcatatgaaaacattcgcttttgattattcc
aatcttatcttcatgttggtcattttcgtttgggatggattcaatattttaagtcccgtg
ataatgatttcaatgaataaaagtctacgaaagcaggtgttcgcaatgagtggc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATCGACATAACATATCCTCTTTGGT 45 37 322 Antisense
ATCCTCTTTGGTTCTATTTTCATGT 177 39 335 Antisense
GTGAATTGGTTTGGCACTACCGCAT 464 481 574 Antisense
ACTACCGCATGGCAACTAACCTATA 186 99 589 Antisense
ATGGCAGTCACACTTCTGTCAAACA 280 53 625 Antisense
TTGTCACAGGAGCAATTCTCTGGAA 184 709 650 Antisense
AGTGCCTGCGCATTTTGTTACTTGC 60 61 748 Antisense
AAACATTCGCTTTTGATTATTCCAA 171 127 779 Antisense
ATTATTCCAATCTTATCTTCATGTT 694 13 794 Antisense
TCATGTTGGTCATTTTCGTTTGGGA 229 615 812 Antisense
AAAGCAGGTGTTCGCAATGAGTGGC 544 117 891 Antisense
Sequence Source Affymetrix Proprietary Database