[Home] | [Total List]

[176555_at]

Description Y39H10A.1 /REP_DB=WormBase Gene ID /WP=CE26072 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 77      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/176555_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4934
1 2 3 4 range
A 26.4
(-3)
A
3
(-3)
A
2.9
(-3)
A
4908.6
(3)
P
4906
B 36.1
(-3)
A
4.3
(-3)
A
7.6
(-3)
A
4080.9
(3)
P
4077
C 53.9
(-2.9)
A
2.8
(-3)
A
5
(-3)
A
4936.4
(3)
P
4934
avr 38.8
(-3)
3.4
(-3)
5.2
(-3)
4642
(3)
4639

Warning: fopen(./gnuplot/176555_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1152
1 2 3 4 5 6 range
A 119.6
(-2.4)
P
6.7
(-3)
A
128.7
(-2.4)
A
125.9
(-2.4)
P
212.5
(-1.9)
P
1135.2
(3)
P
1129
B 112.7
(-2.5)
A
23.2
(-3)
A
127.9
(-2.4)
A
109.1
(-2.5)
P
328.7
(-1.4)
P
1158.5
(3)
P
1135
C 136.9
(-2.4)
A
38.1
(-2.9)
A
25.7
(-3)
A
86.8
(-2.6)
M
248.6
(-1.7)
P
1052.6
(3)
P
1027
avr 123.1
(-2.4)
22.7
(-3)
94.1
(-2.6)
107.3
(-2.5)
263.3
(-1.7)
1115.4
(3)
1093
No Scale

Warning: fopen(./gnuplot/176555_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 869
1 2 3 4 range
A 9.6
(-2.9)
A
0.7
(-3)
A
0.8
(-3)
A
718.5
(3)
P
718
B 11.5
(-2.9)
A
1.1
(-3)
A
1.8
(-3)
A
869.6
(3)
P
869
C 17.8
(-2.9)
A
0.8
(-3)
A
1.8
(-3)
A
832.4
(3)
P
832
avr 13
(-2.9)
0.9
(-3)
1.5
(-3)
806.8
(3)
806

Warning: fopen(./gnuplot/176555_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176555_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 430
1 2 3 4 5 6 range
A 22
(-2.6)
P
2.4
(-3)
A
28
(-2.4)
A
31.9
(-2.4)
P
64.1
(-1.6)
P
276.4
(3)
P
274
B 39.2
(-2.6)
A
7.7
(-3)
A
31.1
(-2.7)
A
28.9
(-2.7)
P
133.5
(-1.2)
P
432
(3)
P
424
C 50.8
(-2.2)
A
11.6
(-2.9)
A
6.5
(-3)
A
17.4
(-2.8)
M
80.5
(-1.7)
P
352.4
(3)
P
346
avr 37.3
(-2.5)
7.2
(-3)
21.9
(-2.7)
26.1
(-2.7)
92.7
(-1.5)
353.6
(3)
346
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176555_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15743
Sequence Type Exemplar sequence
Representative Public ID Y39H10A.1 NCBI
Target Description Y39H10A.1 /REP_DB=WormBase Gene ID /WP=CE26072 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071641(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071641 NCBI Caenorhabditis elegans Y39H10A.1 (Y39H10A.1) mRNA, complete cds. 11/11 None
SNAP00000040122 ENSEMBL cdna:SNAP chromosome:CEL140:V:3766305:3767521:1 10/11 None
GENEFINDER00000040127 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:3767028:3767521:1 11/11 None
Y39H10A.1 ENSEMBL cdna:known chromosome:CEL140:V:3767028:3767548:1 gene:Y39H10A.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:3767027-3767521(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y39H10A.1
Entrez Gene 178793 Entrez gene
SwissProt Q9N3Z1 EMBL-EBI
WormBase CE26072 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAF59487 Hypothetical protein Y39H10A.1 [Caenorhabditis elegans] ref|NP_504042.1| Y39H10A.1 [Caenorhabditis elegans] 1.0E-71
blast AAF59487 Hypothetical protein Y39H10A.1 [Caenorhabditis elegans] ref|NP_504042.1| Y39H10A.1 [Caenorhabditis elegans] 6.0E-65
blast AAB52278 Hypothetical protein R08E5.4 [Caenorhabditis elegans] ref|NP_504043.1| R08E5.4 [Caenorhabditis elegans] 2.0E-16
blast AAB65335 Hypothetical protein F59A7.2 [Caenorhabditis elegans] ref|NP_503550.1| F59A7.2 [Caenorhabditis elegans] 2.0E-14
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504042.1 1 5-24
Y39H10A.1 1 5-24
GENEFINDER00000040127 1 5-24
Sequence
Target Sequence
>C. ELEGANS:176555_AT
atttctaattttcgtagccaccctggccatggcagtggtatacgggtatcccgggaagca
gatggatgccatggaaggtggcccaatgaacatgaccgatatggatccacacggtaacat
gacgggcggcccaatggagcatcgtccggagatgggctcgggcgagaaaaagccgtcgag
aaagcgtcgtgacgccagcgaggacattaagaacgccggacgtaatgccattgggacggt
ggacagcgccggtaacgcagcggtcgacaaggccggggaacttgtgaaaggcggcaccga
ccatattaaagatgcccaagccgccatcaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATTTCTAATTTTCGTAGCCACCCTG 12 17 30 Antisense
CACCCTGGCCATGGCAGTGGTATAC 201 201 48 Antisense
GGATCCACACGGTAACATGACGGGC 322 511 132 Antisense
ATGACGGGCGGCCCAATGGAGCATC 165 43 148 Antisense
GAGCATCGTCCGGAGATGGGCTCGG 121 387 166 Antisense
CGTCGTGACGCCAGCGAGGACATTA 233 245 214 Antisense
GAACGCCGGACGTAATGCCATTGGG 707 343 240 Antisense
TTGGGACGGTGGACAGCGCCGGTAA 104 709 260 Antisense
TAACGCAGCGGTCGACAAGGCCGGG 240 639 282 Antisense
AAGGCGGCACCGACCATATTAAAGA 40 163 317 Antisense
TTAAAGATGCCCAAGCCGCCATCAA 27 685 335 Antisense
Sequence Source Affymetrix Proprietary Database