[Home] | [Total List]

[176057_at]

Description Y65B4A.B /REP_DB=WormBase Gene ID /WP=CE25529 /CHR=1 /FEA=Sanger Annotation /DEF=(ST.LOUIS)
Cluster 6grp_total > 60      4grp_total > 20      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/176057_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 96
1 2 3 4 range
A 41.4
(0.8)
A
17
(-3)
A
19.7
(-2.6)
A
55.6
(3)
A
39
B 73.3
(3)
A
47.7
(0.4)
A
13.5
(-3)
A
27.7
(-1.6)
A
60
C 10.6
(-3)
A
63
(0.3)
A
63.4
(0.3)
A
107
(3)
A
96
avr 41.8
(-1.2)
42.6
(-1)
32.2
(-3)
63.4
(3)
31

Warning: fopen(./gnuplot/176057_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 71
1 2 3 4 5 6 range
A 22.1
(-1.1)
A
12.7
(-2.2)
A
56
(3)
A
30.7
(-0)
A
6.2
(-3)
A
13.5
(-2.1)
A
50
B 38.2
(-0.2)
A
14.3
(-2.2)
A
51.9
(1)
A
74.9
(3)
A
12.7
(-2.3)
A
5.1
(-3)
A
70
C 3.6
(-3)
A
12.6
(3)
A
8.3
(0.1)
A
4.9
(-2.1)
A
9.9
(1.2)
A
11.9
(2.5)
A
9
avr 21.3
(-0.6)
13.2
(-2.3)
38.7
(3)
36.8
(2.6)
9.6
(-3)
10.2
(-2.9)
29
No Scale

Warning: fopen(./gnuplot/176057_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20
1 2 3 4 range
A 15.1
(3)
A
3.7
(-3)
A
5.1
(-2.3)
A
8.1
(-0.7)
A
11
B 23.4
(3)
A
11.8
(-0.4)
A
3.1
(-3)
A
5.9
(-2.2)
A
20
C 3.5
(-3)
A
18.1
(1.7)
A
22.1
(3)
A
18
(1.7)
A
19
avr 14
(3)
11.2
(-1.3)
10.1
(-3)
10.7
(-2.1)
4

Warning: fopen(./gnuplot/176057_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176057_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 19
1 2 3 4 5 6 range
A 4.1
(-1.7)
A
4.5
(-1.5)
A
12.2
(3)
A
7.8
(0.4)
A
1.9
(-3)
A
3.3
(-2.2)
A
10
B 13.3
(0.8)
A
4.8
(-2)
A
12.6
(0.6)
A
19.8
(3)
A
5.2
(-1.9)
A
1.9
(-3)
A
18
C 1.3
(-2.4)
A
3.8
(2.6)
A
2.1
(-0.8)
A
1
(-3)
A
3.2
(1.4)
A
4
(3)
A
3
avr 6.2
(-0.1)
4.4
(-1.8)
9
(2.5)
9.5
(3)
3.4
(-2.7)
3.1
(-3)
6
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 176057_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.18862
Sequence Type Exemplar sequence
Representative Public ID Y65B4A.B NCBI
Target Description Y65B4A.B /REP_DB=WormBase Gene ID /WP=CE25529 /CHR=1 /FEA=Sanger Annotation /DEF=(ST.LOUIS)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade B annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_058365
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
Y65B4A.8.2 ENSEMBL cdna:known chromosome:CEL140:I:659571:663552:-1 gene:Y65B4A.8 None
Y65B4A.8.1 ENSEMBL cdna:known chromosome:CEL140:I:659685:663597:-1 gene:Y65B4A.8 None
GENEFINDER00000032543 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:660008:663745:-1 None
SNAP00000032537 ENSEMBL cdna:SNAP chromosome:CEL140:I:645642:663552:-1 None
NM_058365 NCBI Caenorhabditis elegans Y65B4A.8 (Y65B4A.8) mRNA, complete cds. None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:658362-663552(-) 94.91 100.0
Public Domain and Genome References
Gene Title
Ensembl Y65B4A.8
Entrez Gene 171657 Entrez gene
SwissProt Q9BL56 EMBL-EBI
WormBase CE31383 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:265324_AT cytidylyltransferase domain-containing protein at
CANINE_2:CFA.17036.1.S1_AT similar to Bifunctional coenzyme A synthase (CoA synthase) (NBP) (POV-2) cfa
CANINE_2:CFAAFFX.23002.1.S1_AT similar to Bifunctional coenzyme A synthase (CoA synthase) (NBP) (POV-2) cfa
DROSOPHILA_2:1641488_AT dm
DROSGENOME1:148234_AT dm
CHICKEN:GGAAFFX.11160.1.S1_AT similar to CoA synthase; 4-phosphopantetheine adenylyltransferase and dephospho-CoA kinase gga
HG-U133A_2:201913_S_AT Coenzyme A synthase hs
HG-U133A:201913_S_AT Coenzyme A synthase hs
HG-U133_PLUS_2:201913_S_AT Coenzyme A synthase hs
HG-FOCUS:201913_S_AT Coenzyme A synthase hs
HG-U95AV2:36126_AT Coenzyme A synthase hs
HUGENEFL:U18919_AT Coenzyme A synthase hs
U133_X3P:G13376837_3P_S_AT Coenzyme A synthase hs
HG-U95AV2:36127_G_AT Coenzyme A synthase hs
HG-U95D:82803_AT Coenzyme A synthase hs
MU11KSUBA:AA274664_S_AT Coenzyme A synthase mm
MG-U74AV2:94241_AT Coenzyme A synthase mm
MG-U74AV2:161554_R_AT Coenzyme A synthase mm
MOE430A:1423701_AT Coenzyme A synthase mm
MOUSE430A_2:1423701_AT Coenzyme A synthase mm
MOUSE430_2:1423701_AT Coenzyme A synthase mm
MOE430B:1443829_X_AT Coenzyme A synthase mm
MOUSE430_2:1443829_X_AT Coenzyme A synthase mm
MU19KSUBB:TC31069_AT Coenzyme A synthase (Coasy), mRNA mm
MU19KSUBB:TC32029_AT Coenzyme A synthase (Coasy), mRNA mm
RG-U34C:RC_AI171095_AT alpha-N-acetylglucosaminidase rn
RAE230A:1373304_AT alpha-N-acetylglucosaminidase rn
RAT230_2:1373304_AT alpha-N-acetylglucosaminidase rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
9058 biosynthesis inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
16779 nucleotidyltransferase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK29952 Hypothetical protein Y65B4A.8 [Caenorhabditis elegans] ref|NP_490766.2| Y65B4A.8 [Caenorhabditis elegans] 0.0
blast CAE71585 Hypothetical protein CBG18542 [Caenorhabditis briggsae] 1.0E-162
blast AAK29952 Hypothetical protein Y65B4A.8 [Caenorhabditis elegans] ref|NP_490766.2| Y65B4A.8 [Caenorhabditis elegans] 1.0E-162
blast CAE71585 Hypothetical protein CBG18542 [Caenorhabditis briggsae] 1.0E-159
blast CAE71585 Hypothetical protein CBG18542 [Caenorhabditis briggsae] 1.0E-116
Protein Domains
Database ID Description E-Value
Pfam IPR004820 EMBL-EBI Cytidylyltransferase 2.7E-8
Pfam IPR001977 EMBL-EBI Dephospho-CoA kinase 4.0E-39
Pfam IPR001781 EMBL-EBI Zn-binding protein, LIM 2.5E-7
Pfam IPR004820 EMBL-EBI Cytidylyltransferase 2.7E-8
Pfam IPR001977 EMBL-EBI Dephospho-CoA kinase 3.3E-20
Pfam IPR001977 EMBL-EBI Dephospho-CoA kinase 2.8E-14
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000032543 2 391-413,452-469
Sequence
Target Sequence
>C. ELEGANS:176057_AT
cgaagcggccgcactaatcgaagccggatggcacaaaacgctcgccgaaacgtggaccgt
cttcgtgccagcagatgaagccgtccgtcgagtcgttgcgagggataacctgactgaaga
tcaggccaaggatcgcatgtcgtcacagatttcgaataaggaacgtctcgacaatagcaa
cgtggcgttgtgctctctgtgggcgtacgaggagactcatgcacaggtcgatcgagctgt
ggaagagttgatgaagagaattttaaaaaatttagatcaatcaattatcttcagcttcat
cgtcatcatcgtcgtcgctctcctccttcgtctcactacttccaccctcaatatacttct
cgtactctttccgacgcttctcctcatcctcttccgtctcctcgaccttaaactttgtcc
ggccatcccagagctcggctgtcaatttccgaccgtcaactactcgtccgtgaagatatt
ttacagccatatccgattcttctgtcgttgg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CGAAGCGGCCGCACTAATCGAAGCC 407 253 1275 Antisense
GATGGCACAAAACGCTCGCCGAAAC 404 407 1301 Antisense
GTCCGTCGAGTCGTTGCGAGGGATA 55 477 1357 Antisense
TCAGGCCAAGGATCGCATGTCGTCA 442 617 1395 Antisense
GACTCATGCACAGGTCGATCGAGCT 705 373 1488 Antisense
TCAATTATCTTCAGCTTCATCGTCA 556 633 1555 Antisense
AATATACTTCTCGTACTCTTTCCGA 439 173 1624 Antisense
TCGACCTTAAACTTTGTCCGGCCAT 571 583 1676 Antisense
AGAGCTCGGCTGTCAATTTCCGACC 50 71 1704 Antisense
CGTCAACTACTCGTCCGTGAAGATA 21 247 1728 Antisense
CCATATCCGATTCTTCTGTCGTTGG 167 271 1761 Antisense
Sequence Source Affymetrix Proprietary Database