[Home] | [Total List]

[176037_s_at]

Description B0403.1 /REP_DB=WormBase Gene ID /WP=CE03881 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Cluster 6grp_total > 92      4grp_total > 01      

Scale

Warning: fopen(./gnuplot/176037_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 75
1 2 3 4 range
A 7.5
(-2.2)
A
3.5
(-3)
A
19.3
(0)
A
34.7
(3)
A
31
B 14.2
(3)
A
4.2
(-3)
A
12.4
(1.9)
A
6.2
(-1.8)
A
10
C 12.4
(-2.4)
A
4.6
(-3)
A
22.2
(-1.6)
A
78.4
(3)
P
74
avr 11.4
(-1.8)
4.1
(-3)
18
(-0.7)
39.8
(3)
36

Warning: fopen(./gnuplot/176037_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 26
1 2 3 4 5 6 range
A 3.7
(-2.4)
A
8
(-1.5)
A
27.4
(3)
A
3
(-2.6)
A
26
(2.7)
A
1.3
(-3)
A
26
B 2.1
(-2.6)
A
2.4
(-2.5)
A
3.7
(-1.8)
A
3.1
(-2.1)
A
13.8
(3)
A
1.3
(-3)
A
13
C 7.3
(3)
A
5
(0.8)
A
2.5
(-1.6)
A
3.4
(-0.7)
A
3.4
(-0.7)
A
1
(-3)
A
6
avr 4.4
(-1.5)
5.1
(-1.2)
11.2
(1.5)
3.2
(-2.1)
14.4
(3)
1.2
(-3)
13
No Scale

Warning: fopen(./gnuplot/176037_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12
1 2 3 4 range
A 2.7
(-0.3)
A
0.8
(-3)
A
5
(2.9)
A
5.1
(3)
A
4
B 4.5
(3)
A
1
(-3)
A
2.9
(0.3)
A
1.3
(-2.5)
A
4
C 4.1
(-1.6)
A
1.3
(-3)
A
7.7
(0.2)
A
13.2
(3)
P
12
avr 3.8
(0.1)
1
(-3)
5.2
(1.6)
6.5
(3)
6

Warning: fopen(./gnuplot/176037_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/176037_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 8
1 2 3 4 5 6 range
A 0.7
(-2.7)
A
2.9
(-0.9)
A
6
(1.5)
A
0.8
(-2.6)
A
7.9
(3)
A
0.3
(-3)
A
8
B 0.7
(-2.8)
A
0.8
(-2.6)
A
0.9
(-2.5)
A
0.8
(-2.6)
A
5.6
(3)
A
0.5
(-3)
A
5
C 2.7
(3)
A
1.5
(-0)
A
0.6
(-2.3)
A
0.7
(-2)
A
1.1
(-1)
A
0.3
(-3)
A
2
avr 1.4
(-1.7)
1.7
(-1.3)
2.5
(-0.2)
0.8
(-2.5)
4.9
(3)
0.4
(-3)
5
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 176037_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.16997
Sequence Type Exemplar sequence
Representative Public ID B0403.1 NCBI
Target Description B0403.1 /REP_DB=WormBase Gene ID /WP=CE03881 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076790(11), NM_078446(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076790 NCBI Caenorhabditis elegans B0403.1 (B0403.1) mRNA, complete cds. 11/11 A 
NM_078446 NCBI Caenorhabditis elegans H18N23.1 (H18N23.1) mRNA, complete cds. 11/11 A 
B0403.1 ENSEMBL cdna:known chromosome:CEL140:X:7068829:7069737:1 gene:B0403.1 11/11 A 
H18N23.1 ENSEMBL cdna:known chromosome:CEL140:X:17619887:17622249:1 gene:H18N23.1 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000032029 1/11 Cross Hyb Matching Probes None
SNAP00000023897 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:7068827-7069736(+) 30.99 100.0
Public Domain and Genome References
Gene Title

Ensembl B0403.1
H18N23.1
Entrez Gene 181978 Entrez gene
186751 Entrez gene
SwissProt Q11075 EMBL-EBI
Q9N5M4 EMBL-EBI
WormBase CE03881 Wormbase
CE28736 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6278 RNA-dependent DNA replication inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3723 RNA binding inferred from electronic annotation QuickGO AmiGO
3964 RNA-directed DNA polymerase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF39884 Hypothetical protein H18N23.1 [Caenorhabditis elegans] ref|NP_510847.1| H18N23.1 [Caenorhabditis elegans] 1.0E-127
blast AAC47064 Hypothetical protein B0403.1 [Caenorhabditis elegans] ref|NP_509191.1| B0403.1 [Caenorhabditis elegans] sp|Q11075|YWV1_CAEEL Hypothetical protein B0403.1 in chromosome X 1.0E-112
blast NP_501072 B0478.2 [Caenorhabditis elegans] 1.0E-75
blast T24544 hypothetical protein T05F1.12 - Caenorhabditis elegans 1.0E-75
blast AAF39884 Hypothetical protein H18N23.1 [Caenorhabditis elegans] ref|NP_510847.1| H18N23.1 [Caenorhabditis elegans] 2.0E-68
Sequence
Target Sequence
>C. ELEGANS:176037_S_AT
cattttcgtggattgcaagctaaacttccaaaaacatatcgaatatgtatcaaattctgc
tttcctcaagtgtagacagcttcttcgatgctttcgctttaccaatgtcagtttgtactt
taagttatacaacgtttacgttcaaccgctgctgaattacggatgtgaggtctacaaccc
taactccaaacgtctgataaagctacttgaaatgccgctgaaattctattcaagaagagt
gtatcaacgatgcaatgtctcaaacacgtcgtacgatgatcgactggctcagtcaaatca
aaaatccattcaacaccagcgaattctccaaatattaaggacctaccacaacatcttatc
tggcgaataccattttccggatgtctcagcactaaaga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CATTTTCGTGGATTGCAAGCTAAAC 10 217 54 Antisense
CAAGCTAAACTTCCAAAAACATATC 294 185 69 Antisense
TCCTCAAGTGTAGACAGCTTCTTCG 678 591 116 Antisense
TAGACAGCTTCTTCGATGCTTTCGC 341 653 126 Antisense
ACAACGTTTACGTTCAACCGCTGCT 112 109 182 Antisense
GTTCAACCGCTGCTGAATTACGGAT 242 443 193 Antisense
GATGATCGACTGGCTCAGTCAAATC 380 411 328 Antisense
TCAACACCAGCGAATTCTCCAAATA 82 631 363 Antisense
GACCTACCACAACATCTTATCTGGC 237 383 393 Antisense
ACAACATCTTATCTGGCGAATACCA 462 111 401 Antisense
TTTCCGGATGTCTCAGCACTAAAGA 48 669 427 Antisense
Sequence Source Affymetrix Proprietary Database