[Home] | [Total List]

[175956_at]

Description Y50D4C.D /REP_DB=WormBase Gene ID /WP=CE26546 /CHR=5 /FEA=Sanger Annotation /DEF=(ST.LOUIS)
Cluster 6grp_total > 26      4grp_total > 04      6grp_cgc > 43      6grp_cgc_sub > 02      6grp_total_sub > Cup      

Scale

Warning: fopen(./gnuplot/175956_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 161
1 2 3 4 range
A 28.6
(-1.5)
A
34.1
(-1)
A
13.4
(-3)
A
75.9
(3)
A
63
B 31.1
(-1.9)
A
39.5
(0.1)
A
51.8
(3)
A
26.3
(-3)
A
25
C 71.7
(-0.8)
A
12.2
(-3)
A
40.9
(-1.9)
A
173.2
(3)
A
161
avr 43.8
(-1.6)
28.6
(-3)
35.4
(-2.4)
91.8
(3)
63

Warning: fopen(./gnuplot/175956_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 81
1 2 3 4 5 6 range
A 13.6
(3)
A
7.9
(-0.1)
A
2.5
(-3)
A
7.6
(-0.2)
A
5.1
(-1.6)
A
11.7
(2)
A
11
B 48.5
(3)
A
35.4
(1.1)
A
8.8
(-2.7)
A
10.3
(-2.5)
A
22.8
(-0.7)
A
6.9
(-3)
A
42
C 33
(-0.8)
A
83.1
(3)
A
12.9
(-2.3)
A
10.9
(-2.4)
A
3.1
(-3)
A
6.5
(-2.7)
A
80
avr 31.7
(1.2)
42.1
(3)
8.1
(-3)
9.6
(-2.7)
10.3
(-2.6)
8.4
(-2.9)
34
No Scale

Warning: fopen(./gnuplot/175956_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 26
1 2 3 4 range
A 10.4
(2.4)
A
7.4
(0.1)
A
3.5
(-3)
A
11.1
(3)
A
8
B 9.9
(1)
A
9.8
(0.9)
A
12
(3)
A
5.6
(-3)
A
6
C 23.7
(1.7)
A
3.5
(-3)
A
14.2
(-0.5)
A
29.2
(3)
A
26
avr 14.7
(2.6)
6.9
(-3)
9.9
(-0.9)
15.3
(3)
8

Warning: fopen(./gnuplot/175956_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175956_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 25
1 2 3 4 5 6 range
A 2.5
(2.2)
A
2.8
(3)
A
0.5
(-3)
A
1.9
(0.7)
A
1.5
(-0.4)
A
2.8
(3)
A
2
B 16.9
(3)
A
11.8
(0.9)
A
2.1
(-3)
A
2.7
(-2.8)
A
9.3
(-0.1)
A
2.6
(-2.8)
A
15
C 12.2
(-0.2)
A
25.4
(3)
A
3.3
(-2.4)
A
2.2
(-2.7)
A
1
(-3)
A
2.2
(-2.7)
A
24
avr 10.5
(1.5)
13.3
(3)
2
(-3)
2.3
(-2.8)
3.9
(-2)
2.5
(-2.7)
11
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 175956_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19503
Sequence Type Exemplar sequence
Representative Public ID Y50D4C.D NCBI
Target Description Y50D4C.D /REP_DB=WormBase Gene ID /WP=CE26546 /CHR=5 /FEA=Sanger Annotation /DEF=(ST.LOUIS)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070958(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070958 NCBI Caenorhabditis elegans SQuashed Vulva family member (sqv-6) (sqv-6) mRNA, complete cds. 11/11 None
Y50D4C.4 ENSEMBL cdna:known chromosome:CEL140:V:951435:964630:-1 gene:Y50D4C.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
GENEFINDER00000044739 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:951434-958868(-) 98.54 100.0
Public Domain and Genome References
Gene Title
Gene Symbol sqv-6
Ensembl Y50D4C.4
Entrez Gene 190099 Entrez gene
SwissProt Q965Q8 EMBL-EBI
WormBase CE35919 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
8375 acetylglucosaminyltransferase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK68509 Squashed vulva protein 6 [Caenorhabditis elegans] ref|NP_503359.2| SQuashed Vulva family member (sqv-6) [Caenorhabditis elegans] gb|AAO85277.1| xylosyltransferase [Caenorhabditis elegans] sp|Q965Q8|XYLT_CAEEL Xylosyltransferase sqv-6 (Peptide O-xylosyltransferase) (Squashed vulva protein 6) emb|CAD42732.1| peptide O-xylosyltransferase [Caenorhabditis elegans] 0.0
blast CAI28926 protein xylosyltransferase [Caenorhabditis briggsae] sp|Q5QQ52|XYLT_CAEBR Xylosyltransferase sqv-6 (Peptide O-xylosyltransferase) (Squashed vulva protein 6) 0.0
blast CAE71041 Hypothetical protein CBG17882 [Caenorhabditis briggsae] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR003406 EMBL-EBI Glycosyl transferase, family 14 4.2E-13
Pfam IPR003406 EMBL-EBI Glycosyl transferase, family 14 1.2E-9
Pfam IPR002889 EMBL-EBI Carbohydrate-binding WSC 1.9E-7
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_503359.2 1 12-31
Y50D4C.4 1 12-31
Sequence
Target Sequence
>C. ELEGANS:175956_AT
acggcgcgacgtttgaatttttgattcatagactgtcccatgtgaatttgacggaaaatg
aggagaagcttgtggagcacggatatctattgagagctgtatcgtttggaacaaaatttg
aatggaaagaggagctttgcagggaatatatgggatttgtcactgataacgacactcttc
acacccgcttgcaatggcatccgacagaacatgtgaaaaaagttggagacaagacgagtc
ccgaaatgatattcaaatatcgaaaaggcgatgagctcattgagcaaactgttgtaaagc
cgtacgattcagtgtttggaggacaatttgatagttggaatgttgggaaaaaactctcca
acctgacgacctgttccaatttcttcgtcgacatcatctccccatcgtcacccgatgatg
ctccaccgctcgccacactacattttcccgtttacactgatcaaaacgcgcattgccacg
tggattacctacgccagttcttcaaaattgccgatttttgcacttccggcgacgcttgca
aggaaaagatctggagtacgagctatcccgatcc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACGGCGCGACGTTTGAATTTTTGAT 40 97 1304 Antisense
CACTGATAACGACACTCTTCACACC 456 197 1464 Antisense
CCGCTTGCAATGGCATCCGACAGAA 325 263 1488 Antisense
AAAGCCGTACGATTCAGTGTTTGGA 301 125 1599 Antisense
TGACGACCTGTTCCAATTTCTTCGT 156 571 1667 Antisense
TACATTTTCCCGTTTACACTGATCA 529 643 1742 Antisense
AAAACGCGCATTGCCACGTGGATTA 490 131 1766 Antisense
TTACCTACGCCAGTTCTTCAAAATT 258 681 1788 Antisense
ATTGCCGATTTTTGCACTTCCGGCG 422 7 1810 Antisense
ACTTCCGGCGACGCTTGCAAGGAAA 47 103 1825 Antisense
TCTGGAGTACGAGCTATCCCGATCC 304 607 1853 Antisense
Sequence Source Affymetrix Proprietary Database