[Home] | [Total List]

[175605_s_at] Zinc finger C-x8-C-x5-C-x3-H type (and similar).

Description g1654335 /REP_DB=GenBank Identifier /GB=U62896.1 /PROTEIN_GB=AAB17868.1 /CHR=3 /FEA=Mapped Transcript /DEF=PIE-1
Cluster 6grp_total > 87      4grp_total > 25      6grp_cgc > 58      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/175605_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 160
1 2 3 4 range
A 51.5
(-3)
A
90.7
(-1.5)
A
168.4
(1.4)
A
211.1
(3)
P
160
B 74.1
(-3)
A
126.7
(1)
A
131.7
(1.4)
A
152.7
(3)
P
79
C 79.4
(-3)
A
177.5
(3)
A
122.6
(-0.4)
A
169.6
(2.5)
P
98
avr 68.3
(-3)
131.6
(0.5)
140.9
(1)
177.8
(3)
110

Warning: fopen(./gnuplot/175605_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 972
1 2 3 4 5 6 range
A 81.6
(-3)
A
103.8
(-2.9)
A
137
(-2.6)
A
174.4
(-2.4)
P
434.8
(-0.7)
P
1007.7
(3)
P
926
B 110.7
(-2.9)
A
99.6
(-3)
A
94.8
(-3)
A
246.9
(-1.9)
M
360.2
(-1.1)
P
942.5
(3)
P
848
C 100.7
(-3)
A
149.7
(-2.7)
A
192.6
(-2.4)
A
197.5
(-2.4)
P
569.9
(-0)
P
1053.3
(3)
P
953
avr 97.7
(-3)
117.7
(-2.9)
141.5
(-2.7)
206.3
(-2.3)
455
(-0.6)
1001.2
(3)
904
No Scale

Warning: fopen(./gnuplot/175605_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 32
1 2 3 4 range
A 18.7
(-3)
A
19.7
(-2.8)
A
44
(3)
A
30.9
(-0.1)
P
25
B 23.6
(-3)
A
31.3
(2.2)
A
30.5
(1.7)
A
32.5
(3)
P
9
C 26.3
(-3)
A
51
(3)
A
42.7
(1)
A
28.6
(-2.4)
P
25
avr 22.9
(-3)
34
(1.1)
39.1
(3)
30.7
(-0.1)
16

Warning: fopen(./gnuplot/175605_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175605_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 338
1 2 3 4 5 6 range
A 15
(-3)
A
36.9
(-2.4)
A
29.8
(-2.6)
A
44.2
(-2.2)
P
131.2
(0)
P
245.3
(3)
P
230
B 38.5
(-2.7)
A
33.2
(-2.8)
A
23
(-3)
A
65.4
(-2.2)
M
146.3
(-0.7)
P
351.5
(3)
P
329
C 37.3
(-3)
A
45.7
(-2.8)
A
49
(-2.8)
A
39.7
(-3)
P
184.4
(-0.2)
P
352.6
(3)
P
315
avr 30.3
(-3)
38.6
(-2.8)
33.9
(-2.9)
49.8
(-2.6)
154
(-0.4)
316.5
(3)
286
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 175605_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.19772
Sequence Type Exemplar sequence
Representative Public ID 1654335 NCBI
Target Description g1654335 /REP_DB=GenBank Identifier /GB=U62896.1 /PROTEIN_GB=AAB17868.1 /CHR=3 /FEA=Mapped Transcript /DEF=PIE-1
Cluster Evidence This cluster is supported by a Mapped Transcript.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067218(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067218 NCBI Caenorhabditis elegans Pharynx and Intestine in Excess family member (pie-1) (pie-1) mRNA, complete cds. 11/11 None
SNAP00000016081 ENSEMBL cdna:SNAP chromosome:CEL140:III:12404044:12428962:1 11/11 None
GENEFINDER00000016105 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:12426768:12428962:1 11/11 None
Y49E10.14 ENSEMBL cdna:known chromosome:CEL140:III:12426768:12429050:1 gene:Y49E10.14 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:12426761-12429046(+) 100.0 100.0
Public Domain and Genome References
Gene Title Zinc finger C-x8-C-x5-C-x3-H type (and similar).
Gene Symbol pie-1
Ensembl Y49E10.14
Entrez Gene 176667 Entrez gene
SwissProt Q94131 EMBL-EBI
WormBase CE28134 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from direct assay QuickGO AmiGO
5813 centrosome inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3676 nucleic acid binding inferred from electronic annotation QuickGO AmiGO
16565 general transcriptional repressor activity inferred from direct assay QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB11564 Hypothetical protein Y49E10.14 [Caenorhabditis elegans] ref|NP_499619.1| Pharynx and Intestine in Excess family member (pie-1) [Caenorhabditis elegans] sp|Q94131|PIE1_CAEEL Pharynx and intestine in excess protein 1 (Pie-1 protein) gb|AAB17868.1| PIE-1 [Caenorhabditis elegans] 1.0E-144
blast T27052 hypothetical protein Y49E10.14 - Caenorhabditis elegans 1.0E-141
blast T27052 hypothetical protein Y49E10.14 - Caenorhabditis elegans 9.0E-83
blast CAB11564 Hypothetical protein Y49E10.14 [Caenorhabditis elegans] ref|NP_499619.1| Pharynx and Intestine in Excess family member (pie-1) [Caenorhabditis elegans] sp|Q94131|PIE1_CAEEL Pharynx and intestine in excess protein 1 (Pie-1 protein) gb|AAB17868.1| PIE-1 [Caenorhabditis elegans] 6.0E-82
blast CAE66476 Hypothetical protein CBG11755 [Caenorhabditis briggsae] 6.0E-54
Protein Domains
Database ID Description E-Value
Pfam IPR000571 EMBL-EBI Zn-finger, C-x8-C-x5-C-x3-H type 3.5E-12
Pfam IPR000571 EMBL-EBI Zn-finger, C-x8-C-x5-C-x3-H type 6.7E-10
Pfam IPR000571 EMBL-EBI Zn-finger, C-x8-C-x5-C-x3-H type 3.5E-12
Pfam IPR000571 EMBL-EBI Zn-finger, C-x8-C-x5-C-x3-H type 6.7E-10
Pfam IPR000571 EMBL-EBI Zn-finger, C-x8-C-x5-C-x3-H type 6.7E-10
Sequence
Target Sequence
>C. ELEGANS:175605_S_AT
tcaatcgatcgagttcttcagcatcgaagcatcatgatgagaatcggagacccagcaaca
accacggaagctcgaatcgtcgtcagatttgtcacaatttcgagagaggaaactgcagat
atggtccaagatgccgcttcattcacgtcgaacaaatgcaacatttcaatgcgaatgcga
cggtttacgcgccaccttcttccgattgtccgccgccgattgcctactaccatcatcatc
cacaacatcagcaacaattcctgccatttccaatgccatatttcttggctccaccgccgc
aagctcaacaaggagctccttttccagtgcaatatattccacagcaacatgatttgatga
atagccagccaatgtatgcaccaatggcaccgacatactactatcaaccaattaattcga
atggcatgcccatgatggatgtgactattgatccgaatgccacgggcggtgcgtttgaag
tgttccccgatggattcttctctcagccaccaccaactattatttccta


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCAATCGATCGAGTTCTTCAGCATC 460 633 493 Antisense
GAGAATCGGAGACCCAGCAACAACC 264 391 531 Antisense
AACCACGGAAGCTCGAATCGTCGTC 228 147 552 Antisense
TGCGAATGCGACGGTTTACGCGCCA 327 583 662 Antisense
TTCCTGCCATTTCCAATGCCATATT 488 699 750 Antisense
GAGCTCCTTTTCCAGTGCAATATAT 534 385 805 Antisense
GAATAGCCAGCCAATGTATGCACCA 181 327 851 Antisense
ATGGCACCGACATACTACTATCAAC 327 51 876 Antisense
ATTGATCCGAATGCCACGGGCGGTG 567 3 939 Antisense
GAAGTGTTCCCCGATGGATTCTTCT 584 335 969 Antisense
AGCCACCACCAACTATTATTTCCTA 583 83 997 Antisense
Sequence Source GenBank