[Home] | [Total List]

[175367_s_at]

Description AV179123_rc /REP_DB=TREMBL Accession /GB=AV179123 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk588c3 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 82      6grp_high1_10_10 > 39      6grp_highest_nonorm > 01      6grp_total > 18      4grp_total > 04      6grp_highest_sub > Cu      6grp_high1_sub > Cu      6grp_total_sub > Decrease      

Scale

Warning: fopen(./gnuplot/175367_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12229
1 2 3 4 range
A 2512.2
(-1.8)
P
243.5
(-2.9)
A
117.1
(-3)
A
12291
(3)
P
12174
B 2422.4
(-1.8)
P
318.6
(-2.9)
A
62.2
(-3)
A
11450
(3)
P
11388
C 2393.1
(-1.8)
P
218.2
(-2.9)
A
86.8
(-3)
A
11157.7
(3)
P
11071
avr 2442.6
(-1.8)
260.1
(-2.9)
88.7
(-3)
11632.9
(3)
11544

Warning: fopen(./gnuplot/175367_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3090
1 2 3 4 5 6 range
A 3879
(3)
P
1186.4
(-2.5)
P
924.7
(-3)
P
1689.7
(-1.4)
P
1576.7
(-1.7)
P
2058.4
(-0.7)
P
2954
B 3739.5
(3)
P
1179.5
(-2.2)
P
788.8
(-3)
P
1376.5
(-1.8)
P
1842.3
(-0.9)
P
1979.9
(-0.6)
P
2951
C 3212
(3)
P
1139.9
(-2.4)
P
911.5
(-3)
P
1686.6
(-1)
P
1750.5
(-0.8)
P
2182.9
(0.3)
P
2301
avr 3610.2
(3)
1168.6
(-2.4)
875
(-3)
1584.3
(-1.4)
1723.2
(-1.1)
2073.7
(-0.4)
2735
No Scale

Warning: fopen(./gnuplot/175367_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2426
1 2 3 4 range
A 914.7
(-0)
P
52.9
(-2.9)
A
30.6
(-3)
A
1799.2
(3)
P
1769
B 772.5
(-1.1)
P
78.7
(-2.8)
A
14.4
(-3)
A
2440
(3)
P
2426
C 792.2
(-0.5)
P
62.7
(-2.9)
A
30.3
(-3)
A
1881.4
(3)
P
1851
avr 826.5
(-0.6)
64.8
(-2.9)
25.1
(-3)
2040.2
(3)
2015

Warning: fopen(./gnuplot/175367_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175367_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1110
1 2 3 4 5 6 range
A 715.1
(3)
P
421.9
(-0.4)
P
201.4
(-3)
P
428.5
(-0.3)
P
475.8
(0.2)
P
501.2
(0.5)
P
514
B 1301.2
(3)
P
392.6
(-1.9)
P
191.5
(-3)
P
364.6
(-2.1)
P
748.5
(0)
P
738.3
(-0)
P
1110
C 1190.5
(3)
P
347.8
(-2.3)
P
232
(-3)
P
339.2
(-2.3)
P
566.4
(-0.9)
P
730.7
(0.1)
P
959
avr 1068.9
(3)
387.4
(-1.8)
208.3
(-3)
377.4
(-1.8)
596.9
(-0.3)
656.7
(0.1)
861
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 175367_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20703
Sequence Type Exemplar sequence
Representative Public ID AV179123 NCBI
Target Description AV179123_rc /REP_DB=TREMBL Accession /GB=AV179123 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk588c3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_061979(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_061979 NCBI Caenorhabditis elegans Y110A2AL.4a (Y110A2AL.4) mRNA, complete cds. 11/11 A 
Y110A2AL.4a ENSEMBL cdna:known chromosome:CEL140:II:2839316:2840385:1 gene:Y110A2AL.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_182232 8/11 Cross Hyb Matching Probes A 
SNAP00000036277 8/11 Cross Hyb Matching Probes None
GENEFINDER00000036297 8/11 Cross Hyb Matching Probes None
Y110A2AL.4b 8/11 Cross Hyb Matching Probes A 
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
173630 2 1 NM_061979 175367_s_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:2839702-2840374(+) 100.0 100.0
Public Domain and Genome References
Ensembl Y110A2AL.4
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAO38586 Hypothetical protein Y110A2AL.4a [Caenorhabditis elegans] ref|NP_494380.2| Y110A2AL.4a [Caenorhabditis elegans] 3.0E-94
blast AAO38587 Hypothetical protein Y110A2AL.4b [Caenorhabditis elegans] ref|NP_872032.1| Y110A2AL.4b [Caenorhabditis elegans] 1.0E-81
blast AAF60398 Hypothetical protein Y110A2AL.7 [Caenorhabditis elegans] ref|NP_494382.1| Y110A2AL.7 [Caenorhabditis elegans] 3.0E-47
Sequence
Target Sequence
>C. ELEGANS:175367_S_AT
cgacgttcatcggcactggtaatacccagtctggtatctctggagtagtggagtacgcaa
gaggaggccgtactattctgcttgaagtagttgttgagaagagcccttctagtccatctg
cctacaagtttgcgagtatcagaacaccaccggtcccttcccaacgacgcagtttcccga
cttgtatgctgggattggtcgcgtgctacctccatctcattgatgttttgccaggcagtg
ccgaggaaattcttaactcagtcaaggcatgcaacatctccagagttgaagcagctgcag
aagggatatggtggtaaatgcaccagcatcattttttccaggtgcacatggtgcagccga
catctccacatttttagcacccgtcgcatccagctggctaggtggaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CGACGTTCATCGGCACTGGTAATAC 146 251 69 Antisense
AGGCCGTACTATTCTGCTTGAAGTA 670 53 133 Antisense
TGAGAAGAGCCCTTCTAGTCCATCT 358 569 163 Antisense
TTGCGAGTATCAGAACACCACCGGT 13 691 198 Antisense
GCAGTTTCCCGACTTGTATGCTGGG 205 313 237 Antisense
TATGCTGGGATTGGTCGCGTGCTAC 283 657 253 Antisense
GCTACCTCCATCTCATTGATGTTTT 465 303 273 Antisense
GATGTTTTGCCAGGCAGTGCCGAGG 628 407 290 Antisense
ATGCACCAGCATCATTTTTTCCAGG 570 43 386 Antisense
GGTGCACATGGTGCAGCCGACATCT 105 501 409 Antisense
GTCGCATCCAGCTGGCTAGGTGGAA 403 475 451 Antisense
Sequence Source Affymetrix Proprietary Database