[Home] | [Total List]

[175323_at]

Description AU114474_rc /REP_DB=TREMBL Accession /GB=AU114474 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk719f7 : 3prime end, single read.
Cluster 6grp_total > 87      4grp_total > 08      6grp_cgc > 59      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/175323_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 40
1 2 3 4 range
A 3.3
(-3)
A
5.1
(-2.7)
A
33.3
(1.7)
A
41.4
(3)
A
38
B 16.9
(-0.4)
A
13
(-2.3)
A
11.5
(-3)
A
23.8
(3)
A
12
C 1.7
(-3)
A
3.2
(-1.8)
A
2.3
(-2.5)
A
9.3
(3)
A
8
avr 7.3
(-2.9)
7.1
(-3)
15.7
(-0.1)
24.8
(3)
18

Warning: fopen(./gnuplot/175323_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 273
1 2 3 4 5 6 range
A 3.4
(-3)
A
2.1
(-3)
A
1.9
(-3)
A
40.2
(-1.8)
A
139
(1.3)
P
193.3
(3)
P
191
B 23.4
(-2.5)
A
1.2
(-3)
A
3.7
(-2.9)
A
26.2
(-2.4)
A
128.7
(-0.2)
P
273.9
(3)
P
273
C 19.2
(-2.6)
A
3.7
(-3)
A
15.9
(-2.7)
A
31
(-2.3)
A
85.9
(-0.8)
P
231.6
(3)
P
228
avr 15.3
(-2.7)
2.3
(-3)
7.2
(-2.9)
32.5
(-2.2)
117.9
(0)
232.9
(3)
231
No Scale

Warning: fopen(./gnuplot/175323_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8
1 2 3 4 range
A 1.2
(-2.9)
A
1.1
(-3)
A
8.7
(3)
A
6.1
(0.9)
A
8
B 5.4
(3)
A
3.2
(-1.9)
A
2.7
(-3)
A
5.1
(2.3)
A
3
C 0.6
(-3)
A
0.9
(-1.2)
A
0.8
(-1.8)
A
1.6
(3)
A
1
avr 2.4
(-1.4)
1.7
(-3)
4.1
(2.5)
4.3
(3)
3

Warning: fopen(./gnuplot/175323_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175323_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 102
1 2 3 4 5 6 range
A 0.6
(-3)
A
0.8
(-2.9)
A
0.4
(-3)
A
10.2
(-1.7)
A
41.9
(2.3)
P
47.1
(3)
P
47
B 8.1
(-2.5)
A
0.4
(-3)
A
0.9
(-3)
A
6.9
(-2.6)
A
52.3
(0.1)
P
102.1
(3)
P
102
C 7.1
(-2.5)
A
1.1
(-3)
A
4
(-2.8)
A
6.2
(-2.6)
A
27.8
(-0.9)
P
77.5
(3)
P
76
avr 5.3
(-2.6)
0.8
(-3)
1.8
(-2.9)
7.8
(-2.4)
40.7
(0.2)
75.6
(3)
75
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 175323_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20824
Sequence Type Exemplar sequence
Representative Public ID AU114474 NCBI
Target Description AU114474_rc /REP_DB=TREMBL Accession /GB=AU114474 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk719f7 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063079(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063079 NCBI Caenorhabditis elegans defective in Germ Line Development family member (gld-3) (gld-3) mRNA, complete cds. 11/11 None
T07F8.3b.1 ENSEMBL cdna:known chromosome:CEL140:II:7132572:7135232:1 gene:T07F8.3 11/11 None
T07F8.3b.2 ENSEMBL cdna:known chromosome:CEL140:II:7132573:7135232:1 gene:T07F8.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
174174 2 1 NM_063078 181458_at (11)
NM_063079 175323_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:7134849-7135179(+) 100.0 100.0
Public Domain and Genome References
Ensembl T07F8.3
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAK77630 Defective in germ line development protein 3, isoform b [Caenorhabditis elegans] ref|NP_495480.1| defective in Germ Line Development family member (gld-3) [Caenorhabditis elegans] 0.0
blast AAK77629 Defective in germ line development protein 3, isoform a [Caenorhabditis elegans] ref|NP_495479.1| defective in Germ Line Development family member (gld-3) [Caenorhabditis elegans] 0.0
blast T25864 hypothetical protein T07F8.3 - Caenorhabditis elegans 0.0
Sequence
Target Sequence
>C. ELEGANS:175323_AT
tcctttggtgcgcgttattcttcaaatatttatccattttcttacatagttccacagaac
tttaactttttgaacggaaatttcggtcacctttagaagatctctcgtcatgttatatat
tcatcgtgtaaaatgagctcttcatgaaaaatttgccaaattctggatagttttaagcc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCCTTTGGTGCGCGTTATTCTTCAA 77 591 87 Antisense
AATATTTATCCATTTTCTTACATAG 102 175 111 Antisense
TCCATTTTCTTACATAGTTCCACAG 510 591 119 Antisense
CATAGTTCCACAGAACTTTAACTTT 174 213 131 Antisense
GAAATTTCGGTCACCTTTAGAAGAT 14 1 163 Antisense
GGTCACCTTTAGAAGATCTCTCGTC 324 503 171 Antisense
GAAGATCTCTCGTCATGTTATATAT 106 339 182 Antisense
GTCATGTTATATATTCATCGTGTAA 172 467 193 Antisense
CATCGTGTAAAATGAGCTCTTCATG 474 211 208 Antisense
TGAGCTCTTCATGAAAAATTTGCCA 49 569 220 Antisense
GCCAAATTCTGGATAGTTTTAAGCC 615 265 241 Antisense
Sequence Source Affymetrix Proprietary Database