[Home] | [Total List]

[175169_at]

Description AV180585_rc /REP_DB=TREMBL Accession /GB=AV180585 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk609d3 : 3prime end, single read.
Cluster 6grp_total > 87      4grp_total > 08      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/175169_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 99
1 2 3 4 range
A 4.1
(-3)
A
4.3
(-3)
A
7.1
(-2.8)
A
83.1
(3)
P
79
B 3.9
(-3)
A
4.9
(-2.9)
A
50.4
(3)
A
8.2
(-2.4)
A
47
C 5.6
(-3)
A
10.1
(-2.7)
A
49.2
(-0.3)
A
102.9
(3)
P
97
avr 4.5
(-3)
6.4
(-2.8)
35.6
(0.1)
64.7
(3)
60

Warning: fopen(./gnuplot/175169_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 292
1 2 3 4 5 6 range
A 18.6
(-2.7)
A
6.1
(-3)
A
35.1
(-2.2)
A
55.3
(-1.7)
A
157.5
(1.1)
P
228.9
(3)
P
223
B 29.8
(-2.3)
A
2.3
(-3)
A
13.3
(-2.7)
A
84.8
(-1)
P
121.4
(-0.1)
P
251.5
(3)
P
249
C 4.8
(-3)
A
33.4
(-2.4)
A
6.4
(-3)
A
70.3
(-1.6)
P
85.4
(-1.3)
P
293.9
(3)
P
289
avr 17.7
(-2.9)
13.9
(-3)
18.3
(-2.9)
70.1
(-1.6)
121.4
(-0.4)
258.1
(3)
244
No Scale

Warning: fopen(./gnuplot/175169_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 16
1 2 3 4 range
A 1.5
(-2.7)
A
0.9
(-3)
A
1.8
(-2.5)
A
12.2
(3)
P
11
B 1.2
(-3)
A
1.2
(-3)
A
11.7
(3)
A
1.7
(-2.7)
A
11
C 1.8
(-3)
A
2.9
(-2.6)
A
17.1
(2.9)
A
17.3
(3)
P
16
avr 1.5
(-3)
1.7
(-2.9)
10.2
(2.9)
10.4
(3)
9

Warning: fopen(./gnuplot/175169_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175169_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 98
1 2 3 4 5 6 range
A 3.4
(-2.9)
A
2.2
(-3)
A
7.6
(-2.4)
A
14
(-1.7)
A
47.5
(2.1)
P
55.7
(3)
P
54
B 10.4
(-2.4)
A
0.8
(-3)
A
3.2
(-2.8)
A
22.5
(-1.6)
P
49.3
(0.1)
P
93.8
(3)
P
93
C 1.8
(-3)
A
10.2
(-2.5)
A
1.6
(-3)
A
14.1
(-2.2)
P
27.6
(-1.4)
P
98.4
(3)
P
97
avr 5.2
(-2.9)
4.4
(-3)
4.1
(-3)
16.9
(-2)
41.5
(-0.1)
82.6
(3)
79
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 175169_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20870
Sequence Type Exemplar sequence
Representative Public ID AV180585 NCBI
Target Description AV180585_rc /REP_DB=TREMBL Accession /GB=AV180585 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk609d3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Design Representative Id based pipeline to a Affymetrix Proprietary Database identifier using 1 transcript(s).
Annotation Grade This is a grade R annotation.
Annotation Transcript Cluster (# of Matching Probes) AV180585
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
AV180585 AV180585_rc /REP_DB=TREMBL Accession /GB=AV180585 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk609d3 : 3prime end, single read. None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:7137095-7137375(+) 100.0 100.0
Sequence
Target Sequence
>C. ELEGANS:175169_AT
gaattttcgtgcatctatacttccaattgcaatttatggcactgtcgatgttcccttccc
tatatttaatgttcttccttttttctcccataattcccagttgtttttgatcgcaatatt
gtcccgggtcccatcatatctaggtttgtttcaatgtattccatctttcctttct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAATTTTCGTGCATCTATACTTCCA 164 325 62 Antisense
TTTCGTGCATCTATACTTCCAATTG 262 671 66 Antisense
ACTTCCAATTGCAATTTATGGCACT 122 103 80 Antisense
ATTTATGGCACTGTCGATGTTCCCT 638 15 93 Antisense
TTCCCTTCCCTATATTTAATGTTCT 129 699 112 Antisense
TCCCTATATTTAATGTTCTTCCTTT 17 597 118 Antisense
AATTCCCAGTTGTTTTTGATCGCAA 365 175 153 Antisense
TTTGATCGCAATATTGTCCCGGGTC 655 653 167 Antisense
GGGTCCCATCATATCTAGGTTTGTT 302 497 187 Antisense
AGGTTTGTTTCAATGTATTCCATCT 199 57 203 Antisense
TCAATGTATTCCATCTTTCCTTTCT 435 633 212 Antisense
Sequence Source Affymetrix Proprietary Database