[Home] | [Total List]

[175121_s_at]

Description AV199349_rc /REP_DB=TREMBL Accession /GB=AV199349 /CHR=5 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk544f9 : 3prime end, single read.
Cluster 6grp_total > 78      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/175121_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20136
1 2 3 4 range
A 52.5
(-3)
A
4.1
(-3)
A
20.4
(-3)
A
14412.8
(3)
P
14409
B 5.2
(-3)
A
11.9
(-3)
A
3.5
(-3)
A
14053.1
(3)
P
14050
C 11.5
(-3)
A
3.6
(-3)
A
2.4
(-3)
A
20138.8
(3)
P
20136
avr 23.1
(-3)
6.5
(-3)
8.8
(-3)
16201.6
(3)
16195

Warning: fopen(./gnuplot/175121_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3886
1 2 3 4 5 6 range
A 3
(-3)
A
2.6
(-3)
A
4.1
(-3)
A
53.6
(-2.9)
A
632.5
(-1.9)
P
3462.3
(3)
P
3460
B 2.3
(-3)
A
2.2
(-3)
A
6.1
(-3)
A
3.9
(-3)
A
1006.5
(-1.4)
P
3888.2
(3)
P
3886
C 6.5
(-3)
A
4.3
(-3)
A
2
(-3)
A
4
(-3)
A
1089.9
(-0.8)
P
3015.2
(3)
P
3013
avr 3.9
(-3)
3
(-3)
4.1
(-3)
20.5
(-3)
909.6
(-1.4)
3455.2
(3)
3452
No Scale

Warning: fopen(./gnuplot/175121_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 3395
1 2 3 4 range
A 19.1
(-2.9)
A
0.9
(-3)
A
5.3
(-3)
A
2109.8
(3)
P
2109
B 1.6
(-3)
A
2.9
(-3)
A
0.8
(-3)
A
2994.7
(3)
P
2994
C 3.8
(-3)
A
1
(-3)
A
0.8
(-3)
A
3395.7
(3)
P
3395
avr 8.2
(-3)
1.6
(-3)
2.3
(-3)
2833.4
(3)
2832

Warning: fopen(./gnuplot/175121_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/175121_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1449
1 2 3 4 5 6 range
A 0.5
(-3)
A
0.9
(-3)
A
0.9
(-3)
A
13.6
(-2.9)
A
190.8
(-1.6)
P
843
(3)
P
843
B 0.8
(-3)
A
0.7
(-3)
A
1.5
(-3)
A
1
(-3)
A
408.9
(-1.3)
P
1449.9
(3)
P
1449
C 2.4
(-3)
A
1.3
(-3)
A
0.5
(-3)
A
0.8
(-3)
A
352.7
(-0.9)
P
1009.4
(3)
P
1009
avr 1.2
(-3)
1
(-3)
1
(-3)
5.1
(-3)
317.5
(-1.3)
1100.8
(3)
1100
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 175121_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.21848
Sequence Type Exemplar sequence
Representative Public ID AV199349 NCBI
Target Description AV199349_rc /REP_DB=TREMBL Accession /GB=AV199349 /CHR=5 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk544f9 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_075120(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_075120 NCBI Caenorhabditis elegans Y59A8B.19 (Y59A8B.19) mRNA, complete cds. 11/11 A 
SNAP00000028695 ENSEMBL cdna:SNAP chromosome:CEL140:V:18009804:18010390:1 11/11 None
SNAP00000028696 ENSEMBL cdna:SNAP chromosome:CEL140:V:18012591:18013411:-1 11/11 None
GENEFINDER00000028716 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:18012591:18013411:-1 11/11 None
GENEFINDER00000028732 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:18009804:18010390:1 11/11 None
Y59A8B.19 ENSEMBL cdna:known chromosome:CEL140:V:18009804:18013242:1 gene:Y59A8B.19 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:18012609-18012888(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl Y59A8B.19
Entrez Gene 180178 Entrez gene
SwissProt Q9GRY4 EMBL-EBI
WormBase CE26209 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6418 tRNA aminoacylation for protein translation inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4812 tRNA ligase activity inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAC14415 Hypothetical protein Y59A8B.19 [Caenorhabditis elegans] ref|NP_507521.1| Y59A8B.19 [Caenorhabditis elegans] 5.0E-16
blast CAC14415 Hypothetical protein Y59A8B.19 [Caenorhabditis elegans] ref|NP_507521.1| Y59A8B.19 [Caenorhabditis elegans] 2.0E-15
blast CAC14415 Hypothetical protein Y59A8B.19 [Caenorhabditis elegans] ref|NP_507521.1| Y59A8B.19 [Caenorhabditis elegans] 2.0E-13
Sequence
Target Sequence
>C. ELEGANS:175121_S_AT
cggaggtcttactaacgctctggaaggagcaacaggaggtcttgggggtctatctggcat
tcttggaggagccacaggaggagccaccggagctctcggaggattaactggaaccgtcgg
aggtcttactaacgctctgggaggagcaacaggaggtcttgggggtctatctggcattct
tggaggagctgcaggagga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CGGAGGTCTTACTAACGCTCTGGAA 659 243 13 Antisense
GGTCTTACTAACGCTCTGGAAGGAG 375 1 17 Antisense
GGAGCAACAGGAGGTCTTGGGGGTC 304 519 38 Antisense
ACAGGAGGTCTTGGGGGTCTATCTG 620 105 44 Antisense
GGTCTATCTGGCATTCTTGGAGGAG 245 503 59 Antisense
GCCACCGGAGCTCTCGGAGGATTAA 478 277 95 Antisense
GAGGATTAACTGGAACCGTCGGAGG 141 337 111 Antisense
GTCGGAGGTCTTACTAACGCTCTGG 427 471 128 Antisense
AACAGGAGGTCTTGGGGGTCTATCT 562 119 160 Antisense
TCTATCTGGCATTCTTGGAGGAGCT 351 611 178 Antisense
CATTCTTGGAGGAGCTGCAGGAGGA 31 215 187 Antisense
Sequence Source Affymetrix Proprietary Database