[Home] | [Total List]

[174379_s_at] adenylate kinase like

Description C56636_rc /REP_DB=TREMBL Accession /GB=C56636 /CHR=X /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk265c3 : 3prime end, single read.
Cluster 6grp_total > 03      4grp_total > 05      

Scale

Warning: fopen(./gnuplot/174379_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 234
1 2 3 4 range
A 83.2
(0.2)
A
46.3
(-1.3)
A
6.6
(-3)
A
149.5
(3)
M
143
B 61.3
(-0.6)
P
20.5
(-2.3)
A
3.1
(-3)
A
147.4
(3)
P
144
C 104.4
(-0.5)
P
11
(-3)
A
35.9
(-2.3)
A
236.9
(3)
P
226
avr 83
(-0.5)
25.9
(-2.6)
15.2
(-3)
177.9
(3)
163

Warning: fopen(./gnuplot/174379_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 71
1 2 3 4 5 6 range
A 21.8
(0)
A
32.3
(1.7)
A
40.9
(3)
A
22.9
(0.2)
A
20.4
(-0.2)
A
2.5
(-3)
A
38
B 63.6
(3)
A
33.9
(-0.6)
A
38
(-0.1)
A
22.1
(-2)
A
23.1
(-1.9)
A
13.9
(-3)
A
50
C 47.2
(0.7)
M
73.4
(3)
M
4.2
(-3)
A
60.7
(1.9)
A
52
(1.1)
A
11.9
(-2.3)
A
69
avr 44.2
(2.6)
46.5
(3)
27.7
(-0)
35.2
(1.2)
31.8
(0.6)
9.4
(-3)
37
No Scale

Warning: fopen(./gnuplot/174379_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 39
1 2 3 4 range
A 30.3
(3)
A
10
(-1.3)
A
1.7
(-3)
A
21.9
(1.2)
M
29
B 19.5
(0.7)
P
5.1
(-2.1)
A
0.7
(-3)
A
31.4
(3)
P
31
C 34.6
(2.1)
P
3.2
(-3)
A
12.5
(-1.5)
A
39.9
(3)
P
37
avr 28.1
(2.3)
6.1
(-2.7)
5
(-3)
31.1
(3)
26

Warning: fopen(./gnuplot/174379_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/174379_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 22
1 2 3 4 5 6 range
A 4
(-1.1)
A
11.5
(3)
A
8.9
(1.6)
A
5.8
(-0.1)
A
6.2
(0.1)
A
0.6
(-3)
A
11
B 22.1
(3)
A
11.3
(-0.8)
A
9.2
(-1.6)
A
5.8
(-2.8)
A
9.4
(-1.5)
A
5.2
(-3)
A
17
C 17.5
(1.6)
M
22.4
(3)
M
1.1
(-3)
A
12.2
(0.1)
A
16.8
(1.4)
A
4
(-2.2)
A
21
avr 14.5
(2.7)
15.1
(3)
6.4
(-1.4)
7.9
(-0.7)
10.8
(0.8)
3.3
(-3)
12
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 174379_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.22077
Sequence Type Exemplar sequence
Representative Public ID C56636 NCBI
Target Description C56636_rc /REP_DB=TREMBL Accession /GB=C56636 /CHR=X /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk265c3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_077385(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_077385 NCBI Caenorhabditis elegans F13E6.2 (F13E6.2) mRNA, complete cds. 11/11 A 
F13E6.2 ENSEMBL cdna:known chromosome:CEL140:X:10668205:10674218:-1 gene:F13E6.2 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:10668164-10668725(-) 100.0 100.0
Public Domain and Genome References
Gene Title adenylate kinase like
Ensembl F13E6.2
Entrez Gene 181264 Entrez gene
SwissProt O17803 EMBL-EBI
WormBase CE31475 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:19679_AT adenylate kinase family protein at
ATH1-121501:254052_AT adenylate kinase family protein at
CANINE_2:CFAAFFX.31208.1.S1_S_AT similar to adenylate kinase 5 isoform 1 cfa
CANINE_2:CFAAFFX.31210.1.S1_AT similar to adenylate kinase 5 isoform 1 cfa
CHICKEN:GGA.11941.1.S1_AT adenylate kinase 5 gga
HG-U95C:63410_S_AT adenylate kinase 5 hs
HG-U133_PLUS_2:219308_S_AT adenylate kinase 5 hs
HG-U133A:219308_S_AT adenylate kinase 5 hs
HG-FOCUS:219308_S_AT adenylate kinase 5 hs
HG-U133A_2:219308_S_AT adenylate kinase 5 hs
HU35KSUBA:RC_AA447545_AT adenylate kinase 5 hs
U133_X3P:G6912231_3P_A_AT adenylate kinase 5 hs
U133_X3P:HS.18268.0.S1_3P_A_AT adenylate kinase 5 hs
HG-U133_PLUS_2:222862_S_AT adenylate kinase 5 hs
HG-U133B:222862_S_AT adenylate kinase 5 hs
HG-U95C:58927_AT adenylate kinase 5 hs
HG-U95D:83240_R_AT adenylate kinase 5 hs
HG-U95E:91450_I_AT adenylate kinase 5 hs
HG-U95E:91453_R_AT adenylate kinase 5 hs
HG-U95E:71618_R_AT Adenylate kinase 5 hs
HU35KSUBC:RC_N50729_AT Adenylate kinase 5 hs
MOE430A:1426339_AT adenylate kinase 5 mm
MOUSE430A_2:1426339_AT adenylate kinase 5 mm
MOUSE430_2:1426339_AT adenylate kinase 5 mm
MU19KSUBA:TC17701_AT Adenylate kinase 5 (Ak5), mRNA mm
MU19KSUBC:TC39686_AT Adenylate kinase 5 (Ak5), mRNA mm
RG-U34C:RC_AA817746_AT similar to adenylate kinase isozyme 5 rn
RAE230B:1380866_AT similar to adenylate kinase isozyme 5 rn
RAT230_2:1380866_AT similar to adenylate kinase isozyme 5 rn
RAE230A:1372872_AT Similar to adenylate kinase isozyme 5 rn
RAT230_2:1372872_AT Similar to adenylate kinase isozyme 5 rn
RG-U34C:RC_AI236174_AT Similar to adenylate kinase isozyme 5 rn
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA92123 Hypothetical protein F13E6.2 [Caenorhabditis elegans] emb|CAA15625.2| Hypothetical protein F13E6.2 [Caenorhabditis elegans] ref|NP_509786.2| F13E6.2 [Caenorhabditis elegans] 0.0
blast CAE60813 Hypothetical protein CBG04516 [Caenorhabditis briggsae] 0.0
blast XP_793130 PREDICTED: similar to adenylate kinase 5 isoform 1 [Strongylocentrotus purpuratus] 6.0E-29
Protein Domains
Database ID Description E-Value
Pfam IPR000850 EMBL-EBI Adenylate kinase 9.5E-7
Pfam IPR000850 EMBL-EBI Adenylate kinase 2.7E-7
Pfam IPR007858 EMBL-EBI Dpy-30 1.2E-15
Sequence
Target Sequence
>C. ELEGANS:174379_S_AT
tcggatgcagttcgatctaggatggaatacttcaaaaagaatactcttcccatgttgaaa
acattagatgataaaggcaaacttcgagtggttgatggagatgcagatccagatactgtt
ttcaaagaagttgttcaagttattgatagaacactctacgttgaagacgatggtgacgga
acaagtctcggagattctaaaaaaggaacattgaattcatctctcaattcatctactt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCGGATGCAGTTCGATCTAGGATGG 545 603 13 Antisense
TCGATCTAGGATGGAATACTTCAAA 193 603 24 Antisense
GAATACTCTTCCCATGTTGAAAACA 622 325 51 Antisense
GATGCAGATCCAGATACTGTTTTCA 296 413 112 Antisense
GATACTGTTTTCAAAGAAGTTGTTC 681 423 124 Antisense
TCAAGTTATTGATAGAACACTCTAC 400 631 147 Antisense
GAACACTCTACGTTGAAGACGATGG 677 351 161 Antisense
GACGATGGTGACGGAACAAGTCTCG 641 377 178 Antisense
GTGACGGAACAAGTCTCGGAGATTC 219 483 185 Antisense
AAAGGAACATTGAATTCATCTCTCA 594 121 214 Antisense
AATTCATCTCTCAATTCATCTACTT 133 177 226 Antisense
Sequence Source Affymetrix Proprietary Database