[Home] | [Total List]

[173804_s_at] glycogenin

Description AV194788 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=T25E12.5 /5_PRIME_EXT_DB=WormBase Gene ID /GB=AV194788 /WB_GENE_ID=T25E12.5 /WP=CE16466 /CHR=5 /FEA=Genomic Cluster /DEF=glycogenin; Caenorhabditis elegans cDNA clone:yk633g6 : 5prime end, single read.
Cluster 6grp_high1_10_10 > 88      6grp_total > 78      4grp_total > 51      6grp_high1_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/173804_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 155
1 2 3 4 range
A 119.5
(-0.4)
A
168.9
(3)
A
141.7
(1.1)
A
82.1
(-3)
A
87
B 96.6
(0.3)
A
158.3
(3)
M
105.3
(0.7)
A
20.9
(-3)
A
137
C 162.2
(2.1)
A
175.9
(3)
A
121.3
(-0.5)
A
83.6
(-3)
A
92
avr 126.1
(0.6)
167.7
(3)
122.8
(0.4)
62.2
(-3)
105

Warning: fopen(./gnuplot/173804_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3295
1 2 3 4 5 6 range
A 173.7
(-3)
A
171.8
(-3)
P
170.4
(-3)
M
279.6
(-2.8)
P
1363.4
(-0.8)
P
3378.5
(3)
P
3208
B 156.8
(-2.9)
P
150.6
(-2.9)
A
122.4
(-3)
P
157.9
(-2.9)
P
1378.9
(-0.7)
P
3406.4
(3)
P
3284
C 121.4
(-3)
A
147.4
(-3)
A
192.4
(-2.9)
A
239.3
(-2.8)
P
1297.5
(-0.9)
P
3416
(3)
P
3295
avr 150.6
(-3)
156.6
(-3)
161.7
(-3)
225.6
(-2.9)
1346.6
(-0.8)
3400.3
(3)
3250
No Scale

Warning: fopen(./gnuplot/173804_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 49
1 2 3 4 range
A 43.5
(3)
A
36.7
(1.7)
A
37
(1.8)
A
12
(-3)
A
32
B 30.8
(1.6)
A
39.1
(3)
M
24.4
(0.5)
A
4.5
(-3)
A
35
C 53.7
(3)
A
50.6
(2.5)
A
42.3
(1.3)
A
14.1
(-3)
A
40
avr 42.7
(3)
42.1
(2.9)
34.6
(1.5)
10.2
(-3)
33

Warning: fopen(./gnuplot/173804_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173804_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1241
1 2 3 4 5 6 range
A 32
(-3)
A
61.1
(-2.8)
P
37.1
(-3)
M
70.9
(-2.7)
P
411.4
(-0.1)
P
822.6
(3)
P
791
B 54.6
(-2.9)
P
50.1
(-2.9)
A
29.7
(-3)
P
41.8
(-2.9)
P
560.2
(-0.4)
P
1270.2
(3)
P
1241
C 45
(-3)
A
45
(-3)
A
49
(-3)
A
48.1
(-3)
P
419.8
(-1)
P
1143.5
(3)
P
1099
avr 43.9
(-3)
52.1
(-2.9)
38.6
(-3)
53.6
(-2.9)
463.8
(-0.5)
1078.8
(3)
1040
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173804_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.25386
Sequence Type Exemplar sequence
Representative Public ID AV194788 NCBI
Target Description AV194788 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=T25E12.5 /5_PRIME_EXT_DB=WormBase Gene ID /GB=AV194788 /WB_GENE_ID=T25E12.5 /WP=CE16466 /CHR=5 /FEA=Genomic Cluster /DEF=glycogenin; Caenorhabditis elegans cDNA clone:yk633g6 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074837(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074837 NCBI Caenorhabditis elegans T25E12.5 (glycogenin) mRNA, complete cds. 11/11 None
SNAP00000017071 ENSEMBL cdna:SNAP chromosome:CEL140:V:16747819:16752927:-1 11/11 None
GENEFINDER00000017077 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:16747819:16748830:-1 11/11 None
T25E12.5.2 ENSEMBL cdna:known chromosome:CEL140:V:16747715:16748839:-1 gene:T25E12.5 11/11 None
T25E12.5.1 ENSEMBL cdna:known chromosome:CEL140:V:16747715:16748843:-1 gene:T25E12.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:16747725-16748831(-) 100.0 100.0
Public Domain and Genome References
Gene Title glycogenin
Ensembl T25E12.5
Entrez Gene 180119 Entrez gene
SwissProt O45819 EMBL-EBI
WormBase CE16466 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE_2:CFAAFFX.17350.1.S1_AT similar to glycogenin 2 cfa
CANINE_2:CFAAFFX.17351.1.S1_S_AT similar to glycogenin 2 cfa
CHICKEN:GGA.12008.1.S1_AT similar to glycogenin-2 beta gga
HG-U133_PLUS_2:215695_S_AT glycogenin 2 hs
HG-U133A_2:215695_S_AT glycogenin 2 hs
HG-U133A:215695_S_AT glycogenin 2 hs
HG-U133_PLUS_2:210964_S_AT glycogenin 2 hs
HG-U133A:210964_S_AT glycogenin 2 hs
HG-U133A_2:210964_S_AT glycogenin 2 hs
HG-U133_PLUS_2:210963_S_AT glycogenin 2 hs
HG-U133A:210963_S_AT glycogenin 2 hs
HG-U133A_2:210963_S_AT glycogenin 2 hs
HG-U95AV2:35334_AT glycogenin 2 hs
HU35KSUBB:RC_W88568_AT glycogenin 2 hs
U133_X3P:G2618769_3P_A_AT glycogenin 2 hs
U133_X3P:G2618767_3P_A_AT glycogenin 2 hs
HG-U95D:79588_AT Glycogenin 2 hs
HG-U95D:86692_AT Glycogenin 2 hs
HG-U95E:90373_R_AT Glycogenin 2 hs
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
16051 carbohydrate biosynthesis inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
16758 transferase activity, transferring hexosyl groups inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB04823 Hypothetical protein T25E12.5 [Caenorhabditis elegans] ref|NP_507238.1| T25E12.5 [Caenorhabditis elegans] 1.0E-170
blast CAE67686 Hypothetical protein CBG13253 [Caenorhabditis briggsae] 1.0E-142
blast CAE67686 Hypothetical protein CBG13253 [Caenorhabditis briggsae] 1.0E-141
Protein Domains
Database ID Description E-Value
Pfam IPR002495 EMBL-EBI Glycosyl transferase, family 8 2.5E-65
Pfam IPR002495 EMBL-EBI Glycosyl transferase, family 8 2.5E-65
Sequence
Target Sequence
>C. ELEGANS:173804_S_AT
gccggagaattctactcataccccgccgcctaccgaaaatacggagcacaaaccaaaatt
gttcacttcatcggcgctcagaagccatggaattcgccaccgtcggattcgggtctccac
aagaatgagcactaccagcagtggcactcgttcagcctgcagagcagcagctcgtcggag
gcaccagcagctccaaaggtcgaggatgattcggaaaagcagcgtatcgcctgggaggct
ggacatccggattatcttggaaaagacgctttcaagaatatccaaaaagcacttgacgag
agcatggccgctgtgaagcc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GCCGGAGAATTCTACTCATACCCCG 498 281 581 Antisense
CAAAATTGTTCACTTCATCGGCGCT 86 191 634 Antisense
TCACTTCATCGGCGCTCAGAAGCCA 39 627 643 Antisense
TCAGAAGCCATGGAATTCGCCACCG 125 623 658 Antisense
TCGGATTCGGGTCTCCACAAGAATG 603 601 683 Antisense
CTACCAGCAGTGGCACTCGTTCAGC 321 225 712 Antisense
TCAGCCTGCAGAGCAGCAGCTCGTC 136 625 732 Antisense
CACCAGCAGCTCCAAAGGTCGAGGA 206 203 762 Antisense
AAAGCAGCGTATCGCCTGGGAGGCT 402 123 796 Antisense
GGGAGGCTGGACATCCGGATTATCT 530 495 813 Antisense
ACGAGAGCATGGCCGCTGTGAAGCC 309 93 876 Antisense
Sequence Source Affymetrix Proprietary Database