[Home] | [Total List]

[173657_s_at]

Description CEK119GXR_rc /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=Y77E11A.12 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D66628 /WB_GENE_ID=Y77E11A.12 /WP=CE25613 /CHR=4 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk119g10 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 99      6grp_high1_10_10 > 99      6grp_highest_nonorm > 89      6grp_total > 94      4grp_total > 57      6grp_cgc > 89      6grp_total_sub > Hat      6grp_rule_based > S5      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/173657_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 302
1 2 3 4 range
A 74.7
(-1.6)
A
211.4
(2)
A
250.8
(3)
P
19.9
(-3)
A
231
B 73.2
(-2.6)
A
321.4
(3)
M
208.9
(0.4)
A
56.8
(-3)
A
265
C 94.8
(-2.5)
A
83.6
(-2.8)
A
294.1
(3)
A
77
(-3)
A
217
avr 80.9
(-2.1)
205.5
(1.6)
251.3
(3)
51.2
(-3)
200

Warning: fopen(./gnuplot/173657_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5573
1 2 3 4 5 6 range
A 280.5
(-3)
P
284.5
(-3)
P
339.8
(-2.9)
P
439.9
(-2.8)
P
4830.5
(3)
P
2039.4
(-0.7)
P
4550
B 326.6
(-2.9)
P
250.3
(-3)
P
254
(-3)
P
381.4
(-2.9)
P
5822.9
(3)
P
2717.2
(-0.3)
P
5573
C 303.1
(-3)
P
274.5
(-3)
P
265
(-3)
P
415.6
(-2.8)
P
5477.7
(3)
P
2002.6
(-1)
P
5213
avr 303.4
(-3)
269.8
(-3)
286.3
(-3)
412.3
(-2.8)
5377
(3)
2253.1
(-0.7)
5107
No Scale

Warning: fopen(./gnuplot/173657_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 100
1 2 3 4 range
A 27.2
(-0.7)
A
45.9
(1.1)
A
65.6
(3)
P
2.9
(-3)
A
63
B 23.3
(-2)
A
79.4
(3)
M
48.4
(0.2)
A
12.1
(-3)
A
67
C 31.4
(-1.8)
A
24
(-2.3)
A
102.5
(3)
A
13
(-3)
A
90
avr 27.3
(-1.3)
49.8
(0.9)
72.2
(3)
9.3
(-3)
63

Warning: fopen(./gnuplot/173657_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173657_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2314
1 2 3 4 5 6 range
A 51.7
(-3)
P
101.2
(-2.8)
P
74
(-2.9)
P
111.6
(-2.7)
P
1457.6
(3)
P
496.5
(-1.1)
P
1406
B 113.6
(-2.9)
P
83.3
(-2.9)
P
61.7
(-3)
P
101
(-2.9)
P
2365.8
(3)
P
1013.2
(-0.5)
P
2304
C 112.3
(-2.8)
P
83.8
(-2.9)
P
67.4
(-3)
P
83.6
(-2.9)
P
1772.5
(3)
P
670.4
(-0.9)
P
1705
avr 92.5
(-2.9)
89.4
(-2.9)
67.7
(-3)
98.7
(-2.9)
1865.3
(3)
726.7
(-0.8)
1798
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173657_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.24878
Sequence Type Exemplar sequence
Representative Public ID CEK119GXR NCBI
Target Description CEK119GXR_rc /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=Y77E11A.12 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D66628 /WB_GENE_ID=Y77E11A.12 /WP=CE25613 /CHR=4 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk119g10 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_171268(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_171268 NCBI Caenorhabditis elegans COLlagen family member (col-106) (col-106) mRNA, complete cds. 11/11 None
SNAP00000027314 ENSEMBL cdna:SNAP chromosome:CEL140:IV:1459895:1460785:-1 11/11 None
GENEFINDER00000027318 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:1459895:1460785:-1 11/11 None
Y77E11A.15 ENSEMBL cdna:known chromosome:CEL140:IV:1459863:1460785:-1 gene:Y77E11A.15 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:1459878-1466387(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol col-106
Ensembl Y77E11A.15
Entrez Gene 176955 Entrez gene
SwissProt Q8MXT6 EMBL-EBI
WormBase CE26306 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAM97984 Collagen protein 106 [Caenorhabditis elegans] ref|NP_741318.1| COLlagen family member (col-106) [Caenorhabditis elegans] 2.0E-56
blast CAE68247 Hypothetical protein CBG13922 [Caenorhabditis briggsae] 9.0E-47
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 3.4E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.3E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.4E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.3E-10
Sequence
Target Sequence
>C. ELEGANS:173657_S_AT
aggacttgacggaccagatgggcttgatggacctgatggacatcctggatatgctgcggc
aatcaaggagaattttggaggagcttgcatctcttgcccagcaggaccagctggaccacc
agggccagatggttgtgcaggagagccgggaaccgatggcgccccaggagaagacggaca
gaatggagcaccaggatccccaggaggaccaggagagaccggaccacaaggacatcaagg
aaagcctggaagagccggaccacgaggaccaccgggagccaagggacaaacctaccttcc
aggatcagcaggacatccaggaaacagtggacgtcgtggaccacctggaccaccgggagc
caatggaaagaacggaaagcagggagccgatggaattccaggcgccggaggagcaccagg
acaacacggagttcctggagtcgatggatccgatggagcaccgggagaggatgccgcgcc
aggtggagacgctgcctactgtccatgcccaacgagatcggtggctgtcgaggcagcgcc
atcgcaggcagagcagat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AGGACTTGACGGACCAGATGGGCTT 237 55 1789 Antisense
GATGGGCTTGATGGACCTGATGGAC 311 407 1805 Antisense
CAGGAGAGCCGGGAACCGATGGCGC 552 207 1926 Antisense
AAACCTACCTTCCAGGATCAGCAGG 484 125 2076 Antisense
AACAGTGGACGTCGTGGACCACCTG 637 135 2111 Antisense
GAGCACCAGGACAACACGGAGTTCC 653 389 2199 Antisense
GGAGTTCCTGGAGTCGATGGATCCG 123 519 2216 Antisense
TGGAGCACCGGGAGAGGATGCCGCG 205 547 2242 Antisense
TGTCCATGCCCAACGAGATCGGTGG 598 479 2288 Antisense
AGATCGGTGGCTGTCGAGGCAGCGC 86 67 2303 Antisense
CAGCGCCATCGCAGGCAGAGCAGAT 282 203 2322 Antisense
Sequence Source Affymetrix Proprietary Database