[Home] | [Total List]

[173632_s_at] collagen

Description CEC7464 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=M18.1 /5_PRIME_EXT_DB=WormBase Gene ID /GB=C11746 /WB_GENE_ID=M18.1 /WP=CE06193 /CHR=4 /FEA=Genomic Cluster /DEF=collagen; C.elegans cDNA clone yk122f5 : 5prime end, single read.
Cluster 6grp_total > 94      4grp_total > 62      6grp_cgc > 89      6grp_total_sub > Hat      6grp_rule_based > S5      

Scale

Warning: fopen(./gnuplot/173632_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 130
1 2 3 4 range
A 136
(3)
A
13.8
(-3)
A
48.1
(-1.3)
A
28.1
(-2.3)
A
122
B 101.1
(1.5)
A
131.3
(3)
A
95.6
(1.3)
A
6.5
(-3)
A
125
C 91
(3)
A
24.2
(-2.2)
A
87.5
(2.7)
A
13.2
(-3)
A
78
avr 109.4
(3)
56.4
(-0.4)
77.1
(0.9)
15.9
(-3)
94

Warning: fopen(./gnuplot/173632_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 11097
1 2 3 4 5 6 range
A 87.1
(-3)
A
108.9
(-3)
A
49.3
(-3)
A
655.8
(-2.6)
P
8509.6
(3)
P
4900.3
(0.4)
P
8460
B 78.5
(-3)
A
69.4
(-3)
A
72.7
(-3)
A
512
(-2.7)
P
9208.9
(3)
P
4837.1
(0.1)
P
9140
C 88.7
(-3)
A
48.6
(-3)
A
122.8
(-3)
A
423
(-2.8)
P
11145.1
(3)
P
3678.4
(-1)
P
11097
avr 84.8
(-3)
75.6
(-3)
81.6
(-3)
530.3
(-2.7)
9621.2
(3)
4471.9
(-0.2)
9546
No Scale

Warning: fopen(./gnuplot/173632_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 48
1 2 3 4 range
A 49.5
(3)
A
3
(-3)
A
12.6
(-1.8)
A
4.1
(-2.9)
A
47
B 32.2
(3)
A
32.4
(3)
A
22.2
(1)
A
1.4
(-3)
A
31
C 30.1
(2.9)
A
6.9
(-2)
A
30.5
(3)
A
2.2
(-3)
A
28
avr 37.3
(3)
14.1
(-1)
21.8
(0.3)
2.6
(-3)
35

Warning: fopen(./gnuplot/173632_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173632_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3731
1 2 3 4 5 6 range
A 16.1
(-3)
A
38.7
(-2.9)
A
10.7
(-3)
A
166.3
(-2.6)
P
2567.8
(3)
P
1193.1
(-0.2)
P
2557
B 27.3
(-3)
A
23.1
(-3)
A
17.6
(-3)
A
135.6
(-2.8)
P
3741.5
(3)
P
1803.7
(-0.1)
P
3724
C 32.9
(-3)
A
14.8
(-3)
A
31.3
(-3)
A
85.1
(-2.9)
P
3606.4
(3)
P
1231.4
(-1)
P
3592
avr 25.4
(-3)
25.5
(-3)
19.9
(-3)
129
(-2.8)
3305.2
(3)
1409.4
(-0.5)
3285
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173632_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.24759
Sequence Type Exemplar sequence
Representative Public ID CEC7464 NCBI
Target Description CEC7464 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=M18.1 /5_PRIME_EXT_DB=WormBase Gene ID /GB=C11746 /WB_GENE_ID=M18.1 /WP=CE06193 /CHR=4 /FEA=Genomic Cluster /DEF=collagen; C.elegans cDNA clone yk122f5 : 5prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069896(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069896 NCBI Caenorhabditis elegans M18.1 (collagen) mRNA, complete cds. 11/11 None
SNAP00000023282 ENSEMBL cdna:SNAP chromosome:CEL140:IV:12108741:12110214:-1 11/11 None
GENEFINDER00000023293 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:12108741:12110214:-1 11/11 None
M18.1 ENSEMBL cdna:known chromosome:CEL140:IV:12108713:12110223:-1 gene:M18.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:12108729-12110221(-) 93.31 100.0
Public Domain and Genome References
Gene Title collagen
Gene Symbol col-129
Ensembl M18.1
Entrez Gene 178155 Entrez gene
SwissProt Q21556 EMBL-EBI
WormBase CE06193 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA92826 Hypothetical protein M18.1 [Caenorhabditis elegans] ref|NP_502297.1| M18.1 [Caenorhabditis elegans] 5.0E-47
blast CAE62183 Hypothetical protein CBG06230 [Caenorhabditis briggsae] 2.0E-44
blast CAA92826 Hypothetical protein M18.1 [Caenorhabditis elegans] ref|NP_502297.1| M18.1 [Caenorhabditis elegans] 3.0E-43
blast CAE62183 Hypothetical protein CBG06230 [Caenorhabditis briggsae] 1.0E-40
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 1.8E-24
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.9E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.7E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-12
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 2.3E-12
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.9E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.7E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-12
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_502297.1 1 7-29
M18.1 1 7-29
SNAP00000023282 1 7-29
GENEFINDER00000023293 1 7-29
Sequence
Target Sequence
>C. ELEGANS:173632_S_AT
gatgcattgtgtgtccagctggaccaccaggaccaccaggtcaaccaggacagaatggac
aacgcggaagtgatggacaaccaggacaagatgctatgggaggaggacaaggagctccag
gaccacaaggaccagctggagataatggacaaccaggaagaccaggaaatgacggacgac
caggagctccaggagcaccaggaactcgatctgttggacgcccaggaaccgctggatctc
caggaccacaaggaccaccaggacaaaacggaaatgacggtcaaccaggaaatgatggag
ctccaggacaaccaggacagccaggaccagacggacacccaggacaaccaggaaacgctg
gaccaccaggaactccaggagctgctggacaaccaggaggtgatgctgcctactgcccat
gcccatcccgttcctcagttgttcgtgctcaagccgctgttgctcgcaaccgtcacgtcg
ccgctagacatcgttcggtttcccgtagaaaggcagttgccgccagaagatccaaggctc
gtcgtgttgttgctgccaagcaccgtgccgttgccaagagacatcgtgcc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GATGCATTGTGTGTCCAGCTGGACC 313 413 423 Antisense
AACGCGGAAGTGATGGACAACCAGG 460 145 483 Antisense
GGACAAGATGCTATGGGAGGAGGAC 71 527 506 Antisense
AAATGACGGACGACCAGGAGCTCCA 54 119 589 Antisense
GAGCACCAGGAACTCGATCTGTTGG 658 389 615 Antisense
TCGCCGCTAGACATCGTTCGGTTTC 599 597 900 Antisense
TAGACATCGTTCGGTTTCCCGTAGA 257 651 907 Antisense
TTTCCCGTAGAAAGGCAGTTGCCGC 609 667 921 Antisense
AAGGCAGTTGCCGCCAGAAGATCCA 514 161 932 Antisense
AAGATCCAAGGCTCGTCGTGTTGTT 617 153 949 Antisense
TGCCGTTGCCAAGAGACATCGTGCC 3 585 988 Antisense
Sequence Source Affymetrix Proprietary Database