[Home] | [Total List]

[173403_s_at] caveolin

Description AU116780_rc /REP_DB=TREMBL Accession /GB=AU116780 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk748h2 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 85      6grp_high1_10_10 > 57      4grp_highest_8_8 > 0      4grp_high_8_8 > 36      6grp_highest_nonorm > 99      6grp_total > 58      4grp_total > 36      6grp_highest_sub > Cu      6grp_cgc > 28      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      6grp_total_sub > Cup      

Scale

Warning: fopen(./gnuplot/173403_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 833
1 2 3 4 range
A 522.8
(0)
P
764.1
(3)
P
281.2
(-3)
P
423.7
(-1.2)
P
483
B 602.3
(-0.7)
P
1077.7
(3)
P
305.9
(-3)
P
494.9
(-1.5)
P
772
C 608.2
(-0.8)
P
1113.8
(3)
P
306.6
(-3)
P
568.1
(-1.1)
P
807
avr 577.8
(-0.6)
985.2
(3)
297.9
(-3)
495.6
(-1.3)
687

Warning: fopen(./gnuplot/173403_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3657
1 2 3 4 5 6 range
A 1847.1
(-0.2)
P
1008.5
(-1.6)
P
462.1
(-2.6)
P
207
(-3)
P
438.4
(-2.6)
P
3752.2
(3)
P
3545
B 1715.4
(-0.5)
P
961.6
(-1.8)
P
305.2
(-2.9)
P
229.4
(-3)
P
483.1
(-2.6)
P
3863.9
(3)
P
3635
C 1498.8
(-0.8)
P
836.9
(-1.9)
P
445.9
(-2.6)
P
217.6
(-3)
P
517.4
(-2.5)
P
3636.9
(3)
P
3419
avr 1687.1
(-0.5)
935.7
(-1.8)
404.4
(-2.7)
218
(-3)
479.6
(-2.6)
3751
(3)
3533
No Scale

Warning: fopen(./gnuplot/173403_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 258
1 2 3 4 range
A 190.3
(3)
P
165.9
(1.9)
P
73.5
(-2.5)
P
62
(-3)
P
128
B 192.1
(0.7)
P
266.2
(3)
P
70.9
(-3)
P
105.5
(-1.9)
P
195
C 201.3
(-0.2)
P
320.2
(3)
P
106.9
(-2.7)
P
95.8
(-3)
P
224
avr 194.6
(1)
250.8
(3)
83.8
(-3)
87.8
(-2.9)
167

Warning: fopen(./gnuplot/173403_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173403_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1397
1 2 3 4 5 6 range
A 340.5
(-1)
P
358.7
(-0.9)
P
100.6
(-2.7)
P
52.5
(-3)
P
132.3
(-2.4)
P
913.5
(3)
P
861
B 596.9
(-0.7)
P
320.1
(-1.9)
P
74.1
(-2.9)
P
60.8
(-3)
P
196.3
(-2.4)
P
1440.8
(3)
P
1380
C 555.5
(-0.4)
P
255.4
(-1.9)
P
113.5
(-2.6)
P
43.8
(-3)
P
167.4
(-2.4)
P
1217.5
(3)
P
1174
avr 497.6
(-0.7)
311.4
(-1.6)
96.1
(-2.8)
52.4
(-3)
165.3
(-2.4)
1190.6
(3)
1138
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173403_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.28025
Sequence Type Exemplar sequence
Representative Public ID AU116780 NCBI
Target Description AU116780_rc /REP_DB=TREMBL Accession /GB=AU116780 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk748h2 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069342(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069342 NCBI Caenorhabditis elegans T13F2.8 (caveolin) mRNA, complete cds. 11/11 A 
SNAP00000043476 ENSEMBL cdna:SNAP chromosome:CEL140:IV:9772506:9773338:1 11/11 None
GENEFINDER00000043492 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:9772506:9773338:1 11/11 None
T13F2.8.1 ENSEMBL cdna:known chromosome:CEL140:IV:9772482:9773436:1 gene:T13F2.8 11/11 None
T13F2.8.2 ENSEMBL cdna:known chromosome:CEL140:IV:9772484:9773429:1 gene:T13F2.8 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:9773083-9773349(+) 86.64 86.64
Public Domain and Genome References
Gene Title caveolin
Gene Symbol cav-1
Ensembl T13F2.8
Entrez Gene 177815 Entrez gene
SwissProt Q94051 EMBL-EBI
WormBase CE13633 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16599 caveolar membrane inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03359 Hypothetical protein T13F2.8 [Caenorhabditis elegans] ref|NP_501743.1| T13F2.8 [Caenorhabditis elegans] sp|Q94051|CAV1_CAEEL Caveolin-1 gb|AAB48388.1| caveolin 1.0E-135
blast CAE69013 Hypothetical protein CBG15010 [Caenorhabditis briggsae] 5.0E-95
Protein Domains
Database ID Description E-Value
Pfam IPR001612 EMBL-EBI Caveolin 1.8E-112
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_501743.1 2 147-179,199-221
T13F2.8.1 2 147-179,199-221
T13F2.8.2 2 147-179,199-221
SNAP00000043476 2 147-179,199-221
GENEFINDER00000043492 2 147-179,199-221
Sequence
Target Sequence
>C. ELEGANS:173403_S_AT
cttccattcacaatcatctttgccatcttcttcggacttctcgcatcgatcaacgtcttc
atcattgttccacttggaaaacttctctcgattccaggaactcttctcgccaagctctgg
aactggttgattcatgccatctttgatccaattgccangtgctgttggactaatcttctc
caatttcaacatcagaaaatacggaatcaatcaagaaactactgctccatgcgtc


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CTTCCATTCACAATCATCTTTGCCA 589 219 37 Antisense
TCGCATCGATCAACGTCTTCATCAT 224 601 77 Antisense
GTTCCACTTGGAAAACTTCTCTCGA 281 439 103 Antisense
AACTTCTCTCGATTCCAGGAACTCT 110 139 116 Antisense
TCTCGATTCCAGGAACTCTTCTCGC 72 611 122 Antisense
TTCTCGCCAAGCTCTGGAACTGGTT 420 691 140 Antisense
GGAACTGGTTGATTCATGCCATCTT 586 529 155 Antisense
CATGCCATCTTTGATCCAATTGCCA 347 211 169 Antisense
GTGCTGTTGGACTAATCTTCTCCAA 525 479 195 Antisense
ACTAATCTTCTCCAATTTCAACATC 199 101 205 Antisense
TCAAGAAACTACTGCTCCATGCGTC 670 631 247 Antisense
Sequence Source Affymetrix Proprietary Database