[Home] | [Total List]

[173401_s_at] cell division control protein

Description AV182070_rc /REP_DB=TREMBL Accession /GB=AV182070 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk631g7 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 97      6grp_high1_10_10 > 78      4grp_highest_8_8 > 08      4grp_high_8_8 > 44      6grp_highest_nonorm > 89      6grp_total > 69      4grp_total > 51      6grp_highest_sub > Cu      6grp_cgc > 39      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      6grp_total_sub > Cup      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/173401_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1358
1 2 3 4 range
A 1056.3
(-0.1)
P
1608
(3)
P
1469.5
(2.2)
P
533.2
(-3)
P
1075
B 1097.2
(0)
P
1707
(3)
P
1184.3
(0.5)
P
469.5
(-3)
P
1238
C 1115.7
(0.5)
P
1672.7
(3)
P
1428.7
(1.9)
P
349.2
(-3)
P
1324
avr 1089.7
(0.2)
1662.6
(3)
1360.8
(1.5)
450.6
(-3)
1212

Warning: fopen(./gnuplot/173401_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2663
1 2 3 4 5 6 range
A 1491.1
(-0.8)
P
886.3
(-2.4)
P
656.2
(-3)
P
791.4
(-2.6)
P
1731.6
(-0.2)
P
2962
(3)
P
2306
B 1468.5
(-1.1)
P
985.6
(-2.2)
P
635.6
(-3)
P
778
(-2.7)
P
1806.9
(-0.4)
P
3298.7
(3)
P
2663
C 1325.6
(-1.3)
P
795.5
(-2.6)
P
738.2
(-2.7)
P
636.8
(-3)
P
1645.9
(-0.5)
P
3028.8
(3)
P
2392
avr 1428.4
(-1.1)
889.1
(-2.5)
676.7
(-3)
735.4
(-2.9)
1728.1
(-0.4)
3096.5
(3)
2420
No Scale

Warning: fopen(./gnuplot/173401_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 439
1 2 3 4 range
A 384.6
(3)
P
349.1
(2.3)
P
384.2
(3)
P
78.1
(-3)
P
307
B 349.9
(1.7)
P
421.6
(3)
P
274.4
(0.3)
P
100.1
(-3)
P
322
C 369.3
(1.2)
P
480.9
(2.8)
P
498
(3)
P
58.9
(-3)
P
439
avr 367.9
(2.1)
417.2
(3)
385.5
(2.4)
79
(-3)
338

Warning: fopen(./gnuplot/173401_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173401_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1102
1 2 3 4 5 6 range
A 274.9
(-1.6)
P
315.2
(-1.2)
P
142.9
(-3)
P
200.7
(-2.4)
P
522.5
(0.9)
P
721.2
(3)
P
578
B 511
(-1)
P
328.1
(-2)
P
154.3
(-3)
P
206.1
(-2.7)
P
734.1
(0.2)
P
1230.1
(3)
P
1076
C 491.3
(-0.5)
P
242.7
(-2.2)
P
187.9
(-2.6)
P
128.1
(-3)
P
532.6
(-0.3)
P
1013.9
(3)
P
886
avr 425.7
(-1.1)
295.3
(-2)
161.7
(-3)
178.3
(-2.9)
596.4
(0.2)
988.4
(3)
827
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173401_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.28018
Sequence Type Exemplar sequence
Representative Public ID AV182070 NCBI
Target Description AV182070_rc /REP_DB=TREMBL Accession /GB=AV182070 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk631g7 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071798(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071798 NCBI Caenorhabditis elegans yeast MCM (licensing factor) related family member (mcm-7) (mcm-7) mRNA, complete cds. 11/11 A 
SNAP00000007312 ENSEMBL cdna:SNAP chromosome:CEL140:V:4347012:4349358:1 11/11 None
GENEFINDER00000007331 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:4347012:4349358:1 11/11 None
F32D1.10.2 ENSEMBL cdna:known chromosome:CEL140:V:4346978:4349568:1 gene:F32D1.10 11/11 None
F32D1.10.1 ENSEMBL cdna:known chromosome:CEL140:V:4346980:4349572:1 gene:F32D1.10 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:4349202-4349463(+) 78.48 78.48
Public Domain and Genome References
Gene Title cell division control protein
Gene Symbol mcm-7
Ensembl F32D1.10
Entrez Gene 178831 Entrez gene
SwissProt O16297 EMBL-EBI
WormBase CE09874 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:12926_S_AT prolifera protein (PRL) / DNA replication licensing factor Mcm7 (MCM7) at
ATH1-121501:255513_AT prolifera protein (PRL) / DNA replication licensing factor Mcm7 (MCM7) at
CANINE:1603681_AT similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) cfa
CANINE:1591873_AT similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) cfa
CANINE:1591808_AT similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) cfa
CANINE_2:CFA.5523.1.S1_S_AT similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) cfa
CANINE_2:CFAAFFX.22757.1.S1_S_AT similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) cfa
DROSOPHILA_2:1631517_AT Minichromosome maintenance 7 dm
DROSGENOME1:154815_AT Minichromosome maintenance 7 dm
HG-U95AV2:947_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HC-G110:947_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HG-U133A:208795_S_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HG-U133_PLUS_2:208795_S_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HG-U133A_2:208795_S_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HG-U133_PLUS_2:210983_S_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HG-U133A:210983_S_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HG-U133A_2:210983_S_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
HUGENEFL:D55716_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
U133_X3P:G12751125_3P_A_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
U133_X3P:G1255616_3P_A_AT MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) hs
MOUSE430A_2:1416030_A_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430_2:1416030_A_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOE430A:1416030_A_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430A_2:1416031_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430_2:1416031_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOE430A:1416031_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430A_2:1438320_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOE430A:1438320_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430_2:1438320_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430A_2:1439269_X_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOE430A:1439269_X_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MOUSE430_2:1439269_X_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MU11KSUBA:D26091_S_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
MG-U74AV2:93356_AT minichromosome maintenance deficient 7 (S. cerevisiae) mm
RG-U34A:RC_AA858636_AT minichromosome maintenance protein 7 rn
RAE230A:1388744_AT minichromosome maintenance protein 7 rn
RAT230_2:1388744_AT minichromosome maintenance protein 7 rn
YEAST_2:1773633_AT Component of the hexameric MCM complex, which is important for priming origins of DNA replication in G1 and becomes an active ATP-dependent helicase that promotes DNA melting and elongation when activated by Cdc7p-Dbf4p in S-phase Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6270 DNA replication initiation inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
166 nucleotide binding inferred from electronic annotation QuickGO AmiGO
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
8094 DNA-dependent ATPase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB65356 Yeast mcm (licensing factor) related protein 7 [Caenorhabditis elegans] ref|NP_504199.1| yeast MCM (licensing factor) related family member (mcm-7) [Caenorhabditis elegans] 0.0
blast CAE74193 Hypothetical protein CBG21868 [Caenorhabditis briggsae] 0.0
blast AAH45497 Minichromosome maintenance protein 7 [Danio rerio] gb|AAH65669.1| Minichromosome maintenance protein 7 [Danio rerio] ref|NP_997734.1| minichromosome maintenance protein 7 [Danio rerio] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR001208 EMBL-EBI MCM 1.0E-126
Sequence
Target Sequence
>C. ELEGANS:173401_S_AT
cgccatctcaaacgccattcaaagatgcgctcgcaagggaatcagcgaggttgctctcaa
gaaatgcctggatcaatacactgctaacggtctcttggtcatggatcgccagaacat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CGCCATCTCAAACGCCATTCAAAGA 555 257 33 Antisense
AACGCCATTCAAAGATGCGCTCGCA 109 147 43 Antisense
GATGCGCTCGCAAGGGAATCAGCGA 378 415 56 Antisense
GGGAATCAGCGAGGTTGCTCTCAAG 457 493 69 Antisense
GGTTGCTCTCAAGAAATGCCTGGAT 290 507 81 Antisense
AAATGCCTGGATCAATACACTGCTA 421 117 94 Antisense
GGATCAATACACTGCTAACGGTCTC 601 509 102 Antisense
CAATACACTGCTAACGGTCTCTTGG 427 181 106 Antisense
TAACGGTCTCTTGGTCATGGATCGC 235 639 117 Antisense
GTCTCTTGGTCATGGATCGCCAGAA 134 469 122 Antisense
TCTTGGTCATGGATCGCCAGAACAT 461 619 125 Antisense
Sequence Source Affymetrix Proprietary Database