[Home] | [Total List]

[173235_at] collagen

Description C58401_rc /REP_DB=TREMBL Accession /GB=C58401 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk366e4 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 19      6grp_high1_10_10 > 91      6grp_highest_nonorm > 45      6grp_total > 83      4grp_total > 57      6grp_highest_sub > 05      6grp_cgc > 87      6grp_high1_sub > 05      6grp_cgc_sub > 05      6grp_total_sub > Hat      6grp_rule_based > S5      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/173235_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 3687
1 2 3 4 range
A 6.7
(-3)
A
2620.9
(1.6)
P
3381.7
(3)
P
77.2
(-2.9)
A
3375
B 9.1
(-3)
A
2668.2
(1.3)
P
3694.1
(3)
P
63.1
(-2.9)
A
3685
C 8.5
(-3)
A
2612.3
(1.7)
P
3330.2
(3)
P
99.2
(-2.8)
A
3322
avr 8.1
(-3)
2633.8
(1.6)
3468.7
(3)
79.8
(-2.9)
3461

Warning: fopen(./gnuplot/173235_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5760
1 2 3 4 5 6 range
A 668.3
(-3)
P
1557.4
(-1.9)
P
1366.2
(-2.1)
P
3603.9
(0.8)
P
5335.3
(3)
P
1707.3
(-1.7)
P
4667
B 632.1
(-3)
P
1394.9
(-2)
P
1038
(-2.5)
P
3654.6
(1)
P
5214.5
(3)
P
1515.4
(-1.8)
P
4582
C 394.7
(-3)
P
1337.3
(-2)
P
1254.4
(-2.1)
P
3465.5
(0.2)
P
6154.8
(3)
P
1495
(-1.9)
P
5760
avr 565
(-3)
1429.9
(-2)
1219.5
(-2.2)
3574.7
(0.6)
5568.2
(3)
1572.6
(-1.8)
5003
No Scale

Warning: fopen(./gnuplot/173235_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1158
1 2 3 4 range
A 2.4
(-3)
A
568.9
(0.9)
P
884
(3)
P
11.3
(-2.9)
A
882
B 2.9
(-3)
A
659
(1.6)
P
856
(3)
P
13.4
(-2.9)
A
853
C 2.8
(-3)
A
751
(0.9)
P
1160.7
(3)
P
16.7
(-2.9)
A
1158
avr 2.7
(-3)
659.6
(1.1)
966.9
(3)
13.8
(-2.9)
964

Warning: fopen(./gnuplot/173235_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173235_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1995
1 2 3 4 5 6 range
A 123.2
(-3)
P
553.9
(-1.3)
P
297.5
(-2.3)
P
914
(0.2)
P
1610
(3)
P
415.7
(-1.8)
P
1487
B 220
(-3)
P
464.3
(-2.2)
P
252.1
(-2.9)
P
968
(-0.6)
P
2118.6
(3)
P
565.1
(-1.9)
P
1899
C 146.3
(-3)
P
408.1
(-2.1)
P
319.3
(-2.4)
P
696.9
(-1.2)
P
1991.6
(3)
P
500.5
(-1.8)
P
1845
avr 163.2
(-3)
475.4
(-1.9)
289.6
(-2.6)
859.6
(-0.6)
1906.7
(3)
493.8
(-1.9)
1744
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 173235_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27768
Sequence Type Exemplar sequence
Representative Public ID C58401 NCBI
Target Description C58401_rc /REP_DB=TREMBL Accession /GB=C58401 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk366e4 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067737(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067737 NCBI Caenorhabditis elegans Y38C1BA.3 (collagen) mRNA, complete cds. 11/11 None
Y38C1BA.3 ENSEMBL cdna:known chromosome:CEL140:IV:1817309:1820251:-1 gene:Y38C1BA.3 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:1817465-1818451(-) 97.11 97.11
Public Domain and Genome References
Gene Title collagen
Gene Symbol col-109
Ensembl Y38C1BA.3
Entrez Gene 176988 Entrez gene
SwissProt Q9N527 EMBL-EBI
WormBase CE21569 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF60502 Collagen protein 109 [Caenorhabditis elegans] ref|NP_500138.1| Y38C1BA.3 [Caenorhabditis elegans] 2.0E-58
blast CAE63849 Hypothetical protein CBG08408 [Caenorhabditis briggsae] 1.0E-57
blast CAD66221 Hypothetical protein Y41C4A.19 [Caenorhabditis elegans] ref|NP_871711.1| Y41C4A.19 [Caenorhabditis elegans] 4.0E-18
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 4.8E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.4E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 8.4E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 6.9E-9
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_500138.1 1 12-34
Y38C1BA.3 1 12-34
Sequence
Target Sequence
>C. ELEGANS:173235_AT
gatagatccttcactgttcagcatctcgtcacntattttattgctagtcttcttcttgcc
aattcttcccttcttcatcagcagctgtgttggcaccatcaacacgttctgaaggcattc
gtgtc


BLASTn GenBank NR
Note: "n"'s represent regions that are not probed by the probe sequences.
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GATAGATCCTTCACTGTTCAGCATC 257 425 117 Antisense
ATAGATCCTTCACTGTTCAGCATCT 104 23 118 Antisense
TATTTTATTGCTAGTCTTCTTCTTG 667 661 150 Antisense
TATTGCTAGTCTTCTTCTTGCCAAT 589 665 155 Antisense
CCCTTCTTCATCAGCAGCTGTGTTG 376 259 184 Antisense
TCATCAGCAGCTGTGTTGGCACCAT 206 621 191 Antisense
TCAGCAGCTGTGTTGGCACCATCAA 289 625 194 Antisense
TTGGCACCATCAACACGTTCTGAAG 682 703 206 Antisense
GGCACCATCAACACGTTCTGAAGGC 219 535 208 Antisense
CATCAACACGTTCTGAAGGCATTCG 193 213 213 Antisense
AACACGTTCTGAAGGCATTCGTGTC 671 135 217 Antisense
Sequence Source Affymetrix Proprietary Database