[Home] | [Total List]

[173166_at]

Description AV200797_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV200797 /DEF=Caenorhabditis elegans cDNA clone:yk580g10 : 3prime end, single read.
Cluster 6grp_total > 77      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/173166_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5168
1 2 3 4 range
A 4.4
(-3)
A
23.7
(-3)
A
3.8
(-3)
A
3862.9
(3)
P
3859
B 19.9
(-3)
A
2.8
(-3)
A
6.3
(-3)
A
5169.7
(3)
P
5167
C 5.5
(-3)
A
2.6
(-3)
A
1.8
(-3)
A
3710.4
(3)
P
3709
avr 9.9
(-3)
9.7
(-3)
4
(-3)
4247.7
(3)
4244

Warning: fopen(./gnuplot/173166_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 338
1 2 3 4 5 6 range
A 6.8
(-2.9)
A
4.1
(-2.9)
A
6.1
(-2.9)
A
1.4
(-3)
A
63.6
(-1.5)
A
247.3
(3)
P
246
B 4.8
(-3)
A
5.4
(-3)
A
7.5
(-3)
A
18
(-2.8)
A
79.9
(-1.7)
A
339.6
(3)
P
335
C 1.5
(-3)
A
14.2
(-2.7)
A
7.3
(-2.9)
A
3.7
(-3)
A
63.3
(-1.7)
A
277.1
(3)
P
276
avr 4.4
(-3)
7.9
(-2.9)
7
(-2.9)
7.7
(-2.9)
68.9
(-1.6)
288
(3)
284
No Scale

Warning: fopen(./gnuplot/173166_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1101
1 2 3 4 range
A 1.6
(-3)
A
5.1
(-3)
A
1
(-3)
A
565.4
(3)
P
564
B 6.3
(-3)
A
0.7
(-3)
A
1.5
(-3)
A
1101.7
(3)
P
1101
C 1.8
(-3)
A
0.7
(-3)
A
0.6
(-3)
A
625.6
(3)
P
625
avr 3.2
(-3)
2.2
(-3)
1
(-3)
764.2
(3)
763

Warning: fopen(./gnuplot/173166_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173166_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 126
1 2 3 4 5 6 range
A 1.2
(-2.9)
A
1.5
(-2.9)
A
1.3
(-2.9)
A
0.3
(-3)
A
19.2
(-1.1)
A
60.2
(3)
P
60
B 1.7
(-3)
A
1.8
(-3)
A
1.8
(-3)
A
4.8
(-2.9)
A
32.5
(-1.5)
A
126.6
(3)
P
125
C 0.6
(-3)
A
4.3
(-2.8)
A
1.8
(-2.9)
A
0.7
(-3)
A
20.5
(-1.7)
A
92.8
(3)
P
92
avr 1.2
(-3)
2.5
(-2.9)
1.6
(-3)
1.9
(-3)
24.1
(-1.5)
93.2
(3)
92
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 173166_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27017
Sequence Type Exemplar sequence
Representative Public ID AV200797 NCBI
Target Description AV200797_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV200797 /DEF=Caenorhabditis elegans cDNA clone:yk580g10 : 3prime end, single read.
Cluster Evidence This cluster is supported by a EST Transcript.
Annotation Method Description
Annotation Description This probe set was annotated using the Design Representative Id based pipeline to a UniGene identifier using 1 transcript(s).
Annotation Grade This is a grade R annotation.
Annotation Transcript Cluster (# of Matching Probes) AV200797
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
AV200797 AV200797_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV200797 /DEF=Caenorhabditis elegans cDNA clone:yk580g10 : 3prime end, single read. None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:1957401-1957629(+) 76.0 76.0
Sequence
Target Sequence
>C. ELEGANS:173166_AT
acatcatcatgattcagactcacacgagcatcatcatcatcacggaatggtttccgagta
gtgatgtgtattaacaccaactacctacatatgtacgcctgtgttgttgcaatatcattt
ttttttcaagttttacctagagatcgtaccccttacccttatcataattcttataccgat
tattcactccaatagacgtataaatcc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ACATCATCATGATTCAGACTCACAC 155 107 18 Antisense
TCAGACTCACACGAGCATCATCATC 17 625 31 Antisense
GAATGGTTTCCGAGTAGTGATGTGT 28 333 62 Antisense
GTATTAACACCAACTACCTACATAT 551 447 85 Antisense
ACTACCTACATATGTACGCCTGTGT 122 101 97 Antisense
TATGTACGCCTGTGTTGTTGCAATA 348 655 107 Antisense
GTTGTTGCAATATCATTTTTTTTTC 463 437 120 Antisense
TCAAGTTTTACCTAGAGATCGTACC 658 629 143 Antisense
CCCTTACCCTTATCATAATTCTTAT 619 259 167 Antisense
TTCTTATACCGATTATTCACTCCAA 305 689 185 Antisense
TTCACTCCAATAGACGTATAAATCC 133 683 200 Antisense
Sequence Source Affymetrix Proprietary Database