[Home] | [Total List]

[173162_s_at] kinesin-like protein

Description AV183091_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV183091 /DEF=Caenorhabditis elegans cDNA clone:yk646d9 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 86      6grp_high1_10_10 > 78      4grp_high_8_8 > 44      6grp_highest_nonorm > 93      6grp_total > 69      4grp_total > 51      6grp_highest_sub > Da      6grp_cgc > 39      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      6grp_total_sub > Cup      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/173162_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 272
1 2 3 4 range
A 268
(0.3)
P
390.3
(3)
P
266.8
(0.3)
P
118.8
(-3)
A
272
B 176.7
(-1.3)
P
289.5
(3)
P
263.6
(2)
P
133.4
(-3)
P
156
C 216.1
(-0.5)
P
338.6
(3)
P
269.1
(1)
P
129.1
(-3)
P
210
avr 220.3
(-0.4)
339.5
(3)
266.5
(0.9)
127.1
(-3)
212

Warning: fopen(./gnuplot/173162_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 632
1 2 3 4 5 6 range
A 336.8
(-1.4)
P
263.7
(-2.1)
P
176
(-3)
P
244.4
(-2.3)
P
295.7
(-1.8)
P
770.4
(3)
P
594
B 376.4
(-1.1)
P
287.5
(-1.9)
P
178.4
(-3)
P
243.2
(-2.4)
P
397.8
(-0.9)
P
794.6
(3)
P
616
C 289.7
(-2.1)
P
258.5
(-2.5)
P
203.9
(-3)
P
230.6
(-2.7)
P
362.9
(-1.4)
P
808.2
(3)
P
604
avr 334.3
(-1.5)
269.9
(-2.2)
186.1
(-3)
239.4
(-2.5)
352.1
(-1.4)
791.1
(3)
605
No Scale

Warning: fopen(./gnuplot/173162_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 80
1 2 3 4 range
A 97.6
(3)
P
84.7
(2)
P
69.7
(0.9)
P
17.4
(-3)
A
80
B 56.4
(0.9)
P
71.5
(3)
P
61.1
(1.6)
P
28.4
(-3)
P
43
C 71.5
(0.9)
P
97.3
(3)
P
93.8
(2.7)
P
21.8
(-3)
P
76
avr 75.2
(2.1)
84.5
(3)
74.9
(2.1)
22.5
(-3)
62

Warning: fopen(./gnuplot/173162_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/173162_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 258
1 2 3 4 5 6 range
A 62.1
(-2)
P
93.8
(-0.8)
P
38.3
(-3)
P
62
(-2)
P
89.2
(-1)
P
187.6
(3)
P
149
B 131
(-0.9)
P
95.7
(-1.8)
P
43.3
(-3)
P
64.4
(-2.5)
P
161.6
(-0.2)
P
296.3
(3)
P
253
C 107.4
(-1.4)
P
78.9
(-2.1)
P
51.9
(-2.9)
P
46.4
(-3)
P
117.4
(-1.1)
P
270.5
(3)
P
224
avr 100.2
(-1.4)
89.5
(-1.7)
44.5
(-3)
57.6
(-2.6)
122.7
(-0.7)
251.5
(3)
207
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173162_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.26833
Sequence Type Exemplar sequence
Representative Public ID AV183091 NCBI
Target Description AV183091_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV183091 /DEF=Caenorhabditis elegans cDNA clone:yk646d9 : 3prime end, single read.
Cluster Evidence This cluster is supported by a EST Transcript.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_074181(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_074181 NCBI Caenorhabditis elegans BiMC related Kinase family member (bmk-1) (bmk-1) mRNA, complete cds. 11/11 A 
F23B12.8.2 ENSEMBL cdna:known chromosome:CEL140:V:14455905:14459327:-1 gene:F23B12.8 11/11 A 
F23B12.8.1 ENSEMBL cdna:known chromosome:CEL140:V:14455905:14459479:-1 gene:F23B12.8 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
AB024428 11/11 Negative Strand Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:14456028-14456251(-) 74.33 74.33
Public Domain and Genome References
Gene Title kinesin-like protein
Gene Symbol bmk-1
Ensembl F23B12.8
Entrez Gene 179948 Entrez gene
SwissProt Q9XTM0 EMBL-EBI
WormBase CE09600 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:252548_AT kinesin motor protein-related at
CANINE:1604305_AT similar to kinesin family member 11 cfa
CANINE_2:CFAAFFX.12118.1.S1_S_AT similar to kinesin family member 11 cfa
DROSOPHILA_2:1624620_AT Kinesin-like protein at 61F dm
DROSGENOME1:153851_AT Kinesin-like protein at 61F dm
HG-U133A:204444_AT kinesin family member 11 hs
HG-U133_PLUS_2:204444_AT kinesin family member 11 hs
HG-FOCUS:204444_AT kinesin family member 11 hs
HG-U133A_2:204444_AT kinesin family member 11 hs
HU35KSUBC:RC_AA453159_S_AT kinesin family member 11 hs
HUGENEFL:X85137_S_AT kinesin family member 11 hs
HUGENEFL:U37426_AT kinesin family member 11 hs
U133_X3P:G13699823_3P_AT kinesin family member 11 hs
HG-U95AV2:40726_AT kinesin family member 11 hs
HG-U95D:91448_AT kinesin family member 11 hs
MG-U74AV2:99541_AT kinesin family member 11 mm
MG-U74CV2:170746_F_AT kinesin family member 11 mm
MOE430A:1435306_A_AT kinesin family member 11 mm
MOUSE430A_2:1435306_A_AT kinesin family member 11 mm
MOUSE430_2:1435306_A_AT kinesin family member 11 mm
MOE430A:1452315_AT kinesin family member 11 mm
MOUSE430A_2:1452315_AT kinesin family member 11 mm
MOUSE430_2:1452315_AT kinesin family member 11 mm
MOE430A:1452314_AT kinesin family member 11 mm
MOUSE430A_2:1452314_AT kinesin family member 11 mm
MOUSE430_2:1452314_AT kinesin family member 11 mm
MU19KSUBC:TC37332_AT Kinesin-related mitotic motor protein mm
MU19KSUBC:TC41164_AT Kinesin-related mitotic motor protein mm
MU19KSUBC:TC41164_G_AT Kinesin-related mitotic motor protein mm
RG-U34A:AF035955_AT kinesin-like 1 rn
YEAST_2:1773899_AT Kinesin-related motor protein required for mitotic spindle assembly and chromosome segregation; functionally redundant with Cin8p Sc
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5875 microtubule associated complex inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3774 motor activity inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB01170 Hypothetical protein F23B12.8 [Caenorhabditis elegans] emb|CAB01153.1| Hypothetical protein F23B12.8 [Caenorhabditis elegans] ref|NP_506582.1| BiMC related Kinase family member (bmk-1) [Caenorhabditis elegans] gb|AAG03081.1| bimC kinesin BMK-1 [Caenorhabditis elegans] dbj|BAC19818.1| kinesin like protein KLP-14 [Caenorhabditis elegans] 0.0
blast CAE66550 Hypothetical protein CBG11862 [Caenorhabditis briggsae] 0.0
blast NP_999660 KRP170 [Strongylocentrotus purpuratus] gb|AAG18583.1| KRP170 [Strongylocentrotus purpuratus] 1.0E-122
Protein Domains
Database ID Description E-Value
Pfam IPR001752 EMBL-EBI Kinesin, motor region 1.0E-126
Sequence
Target Sequence
>C. ELEGANS:173162_S_AT
gtcccacaaagaattcttccatcgttcccactcgtctcggagttgaatcagccagtcgaa
cccgaagttcttcttggatttggagaaggaaatgacgactttgacaccgatgaacttgcc
acaaagaagcgtcgtgtcacatccttc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTCCCACAAAGAATTCTTCCATCGT 596 475 19 Antisense
ACAAAGAATTCTTCCATCGTTCCCA 543 111 24 Antisense
TTCCCACTCGTCTCGGAGTTGAATC 450 695 43 Antisense
GAGTTGAATCAGCCAGTCGAACCCG 88 397 58 Antisense
GCCAGTCGAACCCGAAGTTCTTCTT 215 281 69 Antisense
GAACCCGAAGTTCTTCTTGGATTTG 440 147 76 Antisense
GGAAATGACGACTTTGACACCGATG 113 527 106 Antisense
GACTTTGACACCGATGAACTTGCCA 231 373 115 Antisense
TGACACCGATGAACTTGCCACAAAG 554 571 120 Antisense
GAACTTGCCACAAAGAAGCGTCGTG 270 349 130 Antisense
AAAGAAGCGTCGTGTCACATCCTTC 438 123 141 Antisense
Sequence Source Affymetrix Proprietary Database