[Home] | [Total List]

[172838_x_at] anion exchange protein

Description F52B5.1 /REP_DB=WormBase Gene ID /WP=CE27167 /TR=Q20642 /GB=CAA99853.3 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=anion exchange protein
Cluster 6grp_highest_10_10 > 60      6grp_high1_10_10 > 17      4grp_highest_8_8 > 49      4grp_high_8_8 > 41      6grp_highest_nonorm > 02      6grp_total > 06      4grp_total > 54      6grp_highest_sub > De      6grp_cgc > 11      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      4grp_rule_based > L1      

Scale

Warning: fopen(./gnuplot/172838_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2988
1 2 3 4 range
A 3909.4
(3)
P
2041
(-0.8)
P
1655.2
(-1.5)
P
921.8
(-3)
P
2988
B 3627.1
(3)
P
2085.2
(-0.5)
P
1849.7
(-1.1)
P
998.4
(-3)
P
2629
C 3636.6
(3)
P
2210.5
(-0.3)
P
1868.5
(-1.1)
P
1058.5
(-3)
P
2578
avr 3724.4
(3)
2112.2
(-0.5)
1791.1
(-1.2)
992.9
(-3)
2732

Warning: fopen(./gnuplot/172838_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2879
1 2 3 4 5 6 range
A 3475.4
(3)
P
2643.8
(0.3)
P
1790
(-2.6)
P
1658.1
(-3)
P
1837.1
(-2.4)
P
1712.8
(-2.8)
P
1817
B 3995.1
(3)
P
2617.3
(-0.4)
P
1993.6
(-1.9)
P
1964.8
(-1.9)
P
1533.5
(-3)
P
1600
(-2.8)
P
2462
C 4296.4
(3)
P
2581.5
(-0.6)
P
2310.1
(-1.1)
P
1807.5
(-2.2)
P
1873
(-2.1)
P
1417.2
(-3)
P
2879
avr 3922.3
(3)
2614.2
(-0.3)
2031.2
(-1.8)
1810.1
(-2.4)
1747.9
(-2.6)
1576.7
(-3)
2346
No Scale

Warning: fopen(./gnuplot/172838_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1289
1 2 3 4 range
A 1423.4
(3)
P
443
(-1.6)
P
432.7
(-1.6)
P
134.9
(-3)
P
1289
B 1156.7
(3)
P
515
(-1.1)
P
428.6
(-1.6)
P
212.8
(-3)
P
944
C 1203.8
(3)
P
635.5
(-0.3)
P
651.2
(-0.2)
P
178.5
(-3)
P
1025
avr 1261.3
(3)
531.2
(-1)
504.2
(-1.2)
175.4
(-3)
1086

Warning: fopen(./gnuplot/172838_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172838_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1229
1 2 3 4 5 6 range
A 640.7
(-0.3)
P
940.3
(3)
P
389.8
(-3)
P
420.5
(-2.7)
P
554.4
(-1.2)
P
417
(-2.7)
P
551
B 1390.1
(3)
P
871.2
(-0.4)
P
484.1
(-3)
P
520.4
(-2.8)
P
623
(-2.1)
P
596.6
(-2.3)
P
906
C 1592.5
(3)
P
787.7
(-0.9)
P
588
(-1.9)
P
363.5
(-3)
P
606.1
(-1.8)
P
474.4
(-2.5)
P
1229
avr 1207.8
(3)
866.4
(0.4)
487.3
(-2.6)
434.8
(-3)
594.5
(-1.8)
496
(-2.5)
773
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172838_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1777
Sequence Type Exemplar sequence
Representative Public ID F52B5.1 NCBI
Target Description F52B5.1 /REP_DB=WormBase Gene ID /WP=CE27167 /TR=Q20642 /GB=CAA99853.3 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=anion exchange protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_059857(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_059857 NCBI Caenorhabditis elegans Anion/Bicarbonate TranSporter family member (abts-1) (abts-1) mRNA, complete cds. 11/11 A 
SNAP00000039358 ENSEMBL cdna:SNAP chromosome:CEL140:I:8305418:8312669:-1 11/11 None
GENEFINDER00000039365 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:8305418:8314546:-1 11/11 None
F52B5.1 ENSEMBL cdna:known chromosome:CEL140:I:8305055:8315690:-1 gene:F52B5.1 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:8305348-8314337(-) 99.59 99.59
Public Domain and Genome References
Gene Title anion exchange protein
Gene Symbol abts-1
Ensembl F52B5.1
Entrez Gene 172613 Entrez gene
SwissProt Q20642 EMBL-EBI
WormBase CE27167 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:246942_AT anion exchange protein family at
CANINE_2:CFAAFFX.9377.1.S1_S_AT similar to solute carrier family 4, sodium bicarbonate cotransporter, member 7 cfa
CANINE_2:CFAAFFX.9384.1.S1_S_AT similar to solute carrier family 4, sodium bicarbonate cotransporter, member 7 cfa
CANINE_2:CFAAFFX.9392.1.S1_S_AT similar to solute carrier family 4, sodium bicarbonate cotransporter, member 7 cfa
CHICKEN:GGA.11901.1.S1_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
CHICKEN:GGA.9352.1.S1_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
CHICKEN:GGAAFFX.23557.1.S1_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
CHICKEN:GGAAFFX.23557.10.S1_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
CHICKEN:GGAAFFX.7192.1.S1_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
CHICKEN:GGAAFFX.7194.1.S1_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
CHICKEN:GGAAFFX.7203.1.S1_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 gga
HG-U133_PLUS_2:210286_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A:210286_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A_2:210286_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133_PLUS_2:207604_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A:207604_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A_2:207604_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133_PLUS_2:209884_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-FOCUS:209884_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A:209884_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A_2:209884_S_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133_PLUS_2:207603_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A:207603_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U133A_2:207603_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HU35KSUBB:RC_AA188932_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HU35KSUBC:RC_AA243166_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
U133_X3P:G6650103_3P_A_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
U133_X3P:G5051627_3P_A_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
U133_X3P:G4507028_3P_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
U133_X3P:G4507028_3P_A_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
U133_X3P:207603_3P_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U95AV2:34936_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U95B:54598_R_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U95B:56632_R_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U95E:69487_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HG-U95B:47645_AT Solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HU35KSUBD:RC_AA216661_AT Solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
HU35KSUBD:RC_AA442754_AT Solute carrier family 4, sodium bicarbonate cotransporter, member 7 hs
MG-U74AV2:161573_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOE430A:1438673_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOUSE430A_2:1438673_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOUSE430_2:1438673_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOE430B:1455876_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOUSE430_2:1455876_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOE430B:1457528_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MOUSE430_2:1457528_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 mm
MG-U74AV2:93471_AT PREDICTED: similar to sodium bicarbonate cotransporter 2b [Mus musculus], mRNA sequence mm
MU11KSUBA:AA592390_AT PREDICTED: similar to sodium bicarbonate cotransporter 2b [Mus musculus], mRNA sequence mm
MU11KSUBB:MSA.42198.0_S_AT PREDICTED: similar to sodium bicarbonate cotransporter 2b [Mus musculus], mRNA sequence mm
RAE230A:1369160_A_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 rn
RAT230_2:1369160_A_AT solute carrier family 4, sodium bicarbonate cotransporter, member 7 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6820 anion transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5452 inorganic anion exchanger activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA99853 Hypothetical protein F52B5.1 [Caenorhabditis elegans] ref|NP_492258.1| Anion/Bicarbonate TranSporter family member (abts-1) [Caenorhabditis elegans] gb|AAX34415.1| anion transporter ABTS-1 [Caenorhabditis elegans] 0.0
blast ABA18179 sodium dependent chloride bicarbonate anion exchanger alternative variant a [Caenorhabditis elegans] 0.0
blast AAC16758 HCO3 transporter [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR003020 EMBL-EBI HCO3- transporter 1.0E-126
Pfam IPR003020 EMBL-EBI HCO3- transporter 2.6E-45
Pfam IPR003020 EMBL-EBI HCO3- transporter 1.0E-126
Pfam IPR003020 EMBL-EBI HCO3- transporter 1.0E-126
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_492258.1 11 428-450,463-485,518-540,547-564,648-665,681-703,733-752,778-800,833-852,859-878,916-938
F52B5.1 11 428-450,463-485,518-540,547-564,648-665,681-703,733-752,778-800,833-852,859-878,916-938
SNAP00000039358 11 426-448,461-483,516-538,545-562,646-663,679-701,731-750,776-798,831-850,857-876,914-936
GENEFINDER00000039365 11 524-546,559-581,614-636,643-660,744-761,777-799,829-848,874-896,929-948,955-974,1012-1034
Sequence
Target Sequence
>C. ELEGANS:172838_X_AT
tgttcccaattatgcttgtcgtcatggttgcaatccgtaaaatgatggagaaagcgttca
caactacggatcttaaatatttggacgatccgatgccagatttccatctcagaaagaagg
aagatgctaagagacgtcagagtgagagggtaataatttatctaattacatttattttgc
aatttcagggagaagccgtcgaaatcgagtttgacaatgagaatcaggccacgatccacg
ccgtgaaaaccgaagctcatttgcatattccaatggcatcaggaaatgtgattaagattc
cattggcagcaattcaagaaccatcacattcgattaatttgacaaaggaagtgaataata
gtggaatgtggaaacatattacatcagttgattcaaagaattctcttgttcgtgatgttc
cagcttcatcggatccaacttcaagtagagatgctccaattgagcaaccagaggatgatg
atgatccgattatgattaaggtaattcgtccgtctccacacacttcgacatcgaatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGTTCCCAATTATGCTTGTCGTCAT 208 563 2804 Antisense
TTGTCGTCATGGTTGCAATCCGTAA 304 707 2819 Antisense
GAAAGCGTTCACAACTACGGATCTT 626 359 2853 Antisense
GATCCGATGCCAGATTTCCATCTCA 386 417 2890 Antisense
TGAGAATCAGGCCACGATCCACGCC 413 569 3021 Antisense
ATCCACGCCGTGAAAACCGAAGCTC 337 37 3037 Antisense
ACCGAAGCTCATTTGCATATTCCAA 507 89 3052 Antisense
AATTCTCTTGTTCGTGATGTTCCAG 338 177 3202 Antisense
TCCAGCTTCATCGGATCCAACTTCA 6 591 3222 Antisense
TTAAGGTAATTCGTCCGTCTCCACA 473 671 3299 Antisense
TCTCCACACACTTCGACATCGAATT 666 609 3316 Antisense
Sequence Source Affymetrix Proprietary Database