[Home] | [Total List]

[172804_x_at] CUTICLE COLLAGEN 1

Description C24F3.6 /REP_DB=WormBase Gene ID /WP=CE18523 /TR=Q9NAR3 /GB=CAB97232.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=CUTICLE COLLAGEN 1
Cluster 6grp_highest_10_10 > 99      6grp_high1_10_10 > 99      6grp_highest_nonorm > 49      6grp_total > 94      4grp_total > 49      6grp_cgc > 89      6grp_total_sub > Hat      6grp_rule_based > S5      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/172804_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1679
1 2 3 4 range
A 377.1
(-2.5)
M
1668.1
(2.5)
M
1807.1
(3)
M
232.9
(-3)
A
1574
B 366.7
(-2.4)
M
1808.2
(3)
P
1664
(2.5)
P
196.2
(-3)
A
1612
C 129.4
(-3)
A
1690.6
(3)
P
1404.3
(1.9)
M
164.4
(-2.9)
A
1561
avr 291.1
(-2.6)
1722.3
(3)
1625.1
(2.6)
197.8
(-3)
1525

Warning: fopen(./gnuplot/172804_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 14212
1 2 3 4 5 6 range
A 336.4
(-3)
P
927.8
(-2.7)
P
819.5
(-2.7)
P
1609.6
(-2.3)
P
11844.1
(3)
P
6296.1
(0.1)
P
11508
B 364.3
(-3)
P
763
(-2.8)
P
996.9
(-2.6)
P
1441.1
(-2.4)
P
10707.2
(3)
P
5588.9
(0)
P
10343
C 619.2
(-3)
P
898.4
(-2.9)
P
946.3
(-2.9)
P
1383.4
(-2.7)
P
14548.6
(3)
P
4632.8
(-1.3)
P
13929
avr 440
(-3)
863.1
(-2.8)
920.9
(-2.8)
1478
(-2.5)
12366.6
(3)
5505.9
(-0.5)
11927
No Scale

Warning: fopen(./gnuplot/172804_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 462
1 2 3 4 range
A 137.3
(-1.6)
M
362.1
(1.5)
M
472.4
(3)
M
34.1
(-3)
A
438
B 116.9
(-1.9)
M
446.6
(3)
P
385.6
(2.1)
P
41.8
(-3)
A
405
C 42.8
(-2.8)
A
486.1
(3)
P
489.4
(3)
M
27.7
(-3)
A
462
avr 99
(-2.1)
431.6
(2.7)
449.1
(3)
34.5
(-3)
415

Warning: fopen(./gnuplot/172804_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172804_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4646
1 2 3 4 5 6 range
A 62
(-3)
P
330
(-2.5)
P
178.5
(-2.8)
P
408.2
(-2.4)
P
3574
(3)
P
1532.9
(-0.5)
P
3512
B 126.8
(-3)
P
254
(-2.8)
P
242.1
(-2.8)
P
381.7
(-2.6)
P
4350.2
(3)
P
2084.1
(-0.2)
P
4223
C 229.5
(-3)
P
274.1
(-2.9)
P
240.9
(-3)
P
278.2
(-2.9)
P
4707.7
(3)
P
1550.9
(-1.2)
P
4478
avr 139.4
(-3)
286
(-2.8)
220.5
(-2.9)
356
(-2.7)
4210.6
(3)
1722.6
(-0.7)
4071
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172804_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8622
Sequence Type Exemplar sequence
Representative Public ID C24F3.6 NCBI
Target Description C24F3.6 /REP_DB=WormBase Gene ID /WP=CE18523 /TR=Q9NAR3 /GB=CAB97232.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=CUTICLE COLLAGEN 1
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069466(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069466 NCBI Caenorhabditis elegans COLlagen family member (col-124) (col-124) mRNA, complete cds. 11/11 None
SNAP00000043526 ENSEMBL cdna:SNAP chromosome:CEL140:IV:10216449:10217374:1 11/11 None
GENEFINDER00000043530 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:10216449:10217374:1 11/11 None
C24F3.6 ENSEMBL cdna:known chromosome:CEL140:IV:10216422:10217456:1 gene:C24F3.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_071851 1/11 Cross Hyb Matching Probes A 
NM_077847 1/11 Cross Hyb Matching Probes A 
NM_069160 1/11 Cross Hyb Matching Probes A 
NM_059385 1/11 Cross Hyb Matching Probes A 
NM_062965 1/11 Cross Hyb Matching Probes A 
NM_182248 1/11 Cross Hyb Matching Probes A 
NM_075994 1/11 Cross Hyb Matching Probes A 
NM_077846 1/11 Cross Hyb Matching Probes A 
NM_063409 1/11 Cross Hyb Matching Probes A 
NM_072334 1/11 Cross Hyb Matching Probes A 
NM_077154 1/11 Cross Hyb Matching Probes None
SNAP00000000073 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000088 1/11 Cross Hyb Matching Probes None
SNAP00000013421 1/11 Cross Hyb Matching Probes None
GENEFINDER00000013453 1/11 Cross Hyb Matching Probes None
SNAP00000010839 1/11 Cross Hyb Matching Probes None
GENEFINDER00000010850 1/11 Cross Hyb Matching Probes None
SNAP00000000290 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000294 1/11 Cross Hyb Matching Probes None
SNAP00000003708 1/11 Cross Hyb Matching Probes None
GENEFINDER00000003712 1/11 Cross Hyb Matching Probes None
SNAP00000023063 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 1/11 Cross Hyb Matching Probes None
SNAP00000035387 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035400 1/11 Cross Hyb Matching Probes None
SNAP00000028415 1/11 Cross Hyb Matching Probes None
GENEFINDER00000028425 1/11 Cross Hyb Matching Probes None
SNAP00000008502 1/11 Cross Hyb Matching Probes None
GENEFINDER00000008503 1/11 Cross Hyb Matching Probes None
SNAP00000039146 1/11 Cross Hyb Matching Probes None
GENEFINDER00000039152 1/11 Cross Hyb Matching Probes None
T05E7.2 1/11 Cross Hyb Matching Probes A 
T14B4.7a.2 1/11 Cross Hyb Matching Probes A 
T14B4.7a.1 1/11 Cross Hyb Matching Probes A 
T14B4.7b.1 1/11 Cross Hyb Matching Probes None
T14B4.7b.2 1/11 Cross Hyb Matching Probes None
F54C9.4 1/11 Cross Hyb Matching Probes A 
C53B4.5 1/11 Cross Hyb Matching Probes A 
F41F3.4 1/11 Cross Hyb Matching Probes A 
T15B7.5 1/11 Cross Hyb Matching Probes A 
EGAP7.1.2 1/11 Cross Hyb Matching Probes None
C35B8.1 1/11 Cross Hyb Matching Probes A 
F02D10.1 1/11 Cross Hyb Matching Probes A 
F15A2.1 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:10216454-10217380(+) 90.98 100.0
Public Domain and Genome References
Gene Title CUTICLE COLLAGEN 1
Gene Symbol col-124
Ensembl C24F3.6
Entrez Gene 177901 Entrez gene
SwissProt Q9NAR3 EMBL-EBI
WormBase CE18523 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB97232 Hypothetical protein C24F3.6 [Caenorhabditis elegans] ref|NP_501867.1| COLlagen family member (col-124) [Caenorhabditis elegans] 3.0E-68
blast CAE59909 Hypothetical protein CBG03393 [Caenorhabditis briggsae] 3.0E-64
blast CAA92453 Hypothetical protein C53B4.5 [Caenorhabditis elegans] ref|NP_501561.1| C53B4.5 [Caenorhabditis elegans] 7.0E-58
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 1.6E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 8.5E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.9E-12
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_501867.1 1 12-34
C24F3.6 1 12-34
SNAP00000043526 1 12-34
GENEFINDER00000043530 1 12-34
Sequence
Target Sequence
>C. ELEGANS:172804_X_AT
gacaatgcgagggatgctgccttccgggagcacaaggaccaccaggaaccccaggaagcg
ctggacgcccaggaaagccaggagctcctggactcaacggaaatccaggacgcccaccaa
aggagccatgtgagccactcactccaccaccatgcaagccatgcccagaaggaccaccag
gaccagccggaccaccaggaccagacggaaacaagggaccacttggaccaccaggaccac
caggaccagaaggaccaaacggagagccaggaaacaaggggccagccggaccaccaggac
caggaggaaagccaggaccagctggaccaccaggagaaaacggaaacaacggtgagccac
agccaggagcaccaggagagccaggacaaccaggacagccagggcaacgcggaccagctg
gagagccaggaaaggatggatccccgggaggacaaggagagaagggagccagtggagagc
caggacagccaggaagagatggccaaccaggacatccaggacaaccaggaaaggatggac
gtccaggagaaaagggagtgtgtccaaagtattgcgctctcg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GACAATGCGAGGGATGCTGCCTTCC 187 365 269 Antisense
GGAGCTCCTGGACTCAACGGAAATC 615 521 349 Antisense
AAAGGAGCCATGTGAGCCACTCACT 581 121 387 Antisense
GGACCACCAGGACCAGAAGGACCAA 404 523 502 Antisense
GAGCCAGGAAACAAGGGGCCAGCCG 542 385 532 Antisense
AACGGAAACAACGGTGAGCCACAGC 349 137 607 Antisense
CCAGGACAACCAGGACAGCCAGGGC 1 273 649 Antisense
GGATGGATCCCCGGGAGGACAAGGA 121 515 702 Antisense
AGAAGGGAGCCAGTGGAGAGCCAGG 420 75 728 Antisense
GGCCAACCAGGACATCCAGGACAAC 499 543 769 Antisense
GTGTGTCCAAAGTATTGCGCTCTCG 520 487 826 Antisense
Sequence Source Affymetrix Proprietary Database