[Home] | [Total List]

[172802_x_at] cuticular collagen

Description C18H7.3 /REP_DB=WormBase Gene ID /WP=CE17428 /TR=Q9GZF7 /GB=AAF98609.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=cuticular collagen
Cluster 6grp_total > 94      4grp_total > 56      6grp_cgc > 87      6grp_cgc_sub > 05      6grp_total_sub > Hat      6grp_rule_based > S5      

Scale

Warning: fopen(./gnuplot/172802_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 521
1 2 3 4 range
A 12.5
(-3)
A
533.6
(3)
A
274.8
(0)
A
20.1
(-2.9)
A
521
B 17.9
(-3)
A
45.7
(-2.6)
A
412.7
(3)
A
16.1
(-3)
A
397
C 20.1
(-2.9)
A
18.5
(-2.9)
A
261
(3)
A
14.6
(-3)
A
246
avr 16.8
(-3)
199.3
(0.7)
316.2
(3)
16.9
(-3)
299

Warning: fopen(./gnuplot/172802_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12043
1 2 3 4 5 6 range
A 229.5
(-3)
A
178.8
(-3)
A
334.2
(-2.9)
A
10488.2
(3)
P
9083
(2.2)
P
3826
(-0.9)
P
10309
B 122.9
(-3)
A
156.6
(-3)
A
238.7
(-2.9)
A
6406.2
(0.9)
P
9845.1
(3)
P
2318.7
(-1.6)
P
9722
C 230.6
(-3)
A
210.2
(-3)
A
167.8
(-3)
A
6107
(-0)
P
12165.4
(3)
P
1696.7
(-2.2)
P
11998
avr 194.3
(-3)
181.9
(-3)
246.9
(-3)
7667.1
(1.4)
10364.5
(3)
2613.8
(-1.6)
10183
No Scale

Warning: fopen(./gnuplot/172802_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 113
1 2 3 4 range
A 4.6
(-2.9)
A
115.8
(3)
A
71.8
(0.7)
A
2.9
(-3)
A
113
B 5.7
(-2.9)
A
11.3
(-2.5)
A
95.6
(3)
A
3.4
(-3)
A
92
C 6.7
(-2.7)
A
5.3
(-2.8)
A
91
(3)
A
2.5
(-3)
A
89
avr 5.7
(-2.8)
44.1
(-0)
86.1
(3)
2.9
(-3)
83

Warning: fopen(./gnuplot/172802_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172802_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3958
1 2 3 4 5 6 range
A 42.3
(-3)
A
63.6
(-3)
A
72.8
(-2.9)
A
2660
(2.8)
P
2740.8
(3)
P
931.5
(-1)
P
2699
B 42.8
(-3)
A
52.1
(-3)
A
58
(-3)
A
1696.8
(-0.5)
P
3999.9
(3)
P
864.6
(-1.8)
P
3957
C 85.5
(-2.9)
A
64.1
(-3)
A
42.7
(-3)
A
1228.1
(-1.2)
P
3936.5
(3)
P
568
(-2.2)
P
3894
avr 56.9
(-3)
59.9
(-3)
57.8
(-3)
1861.6
(0.1)
3559.1
(3)
788
(-1.7)
3502
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172802_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.10551
Sequence Type Exemplar sequence
Representative Public ID C18H7.3 NCBI
Target Description C18H7.3 /REP_DB=WormBase Gene ID /WP=CE17428 /TR=Q9GZF7 /GB=AAF98609.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=cuticular collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067556(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067556 NCBI Caenorhabditis elegans COLlagen family member (col-102) (col-102) mRNA, complete cds. 11/11 None
SNAP00000042867 ENSEMBL cdna:SNAP chromosome:CEL140:IV:604444:605876:1 11/11 None
GENEFINDER00000042874 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:604444:605876:1 11/11 None
C18H7.3 ENSEMBL cdna:known chromosome:CEL140:IV:604444:605876:1 gene:C18H7.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:604449-605882(+) 67.9 100.0
Public Domain and Genome References
Gene Title cuticular collagen
Gene Symbol col-102
Ensembl C18H7.3
Entrez Gene 182802 Entrez gene
SwissProt Q9GZF7 EMBL-EBI
WormBase CE17428 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF98609 Collagen protein 102 [Caenorhabditis elegans] ref|NP_499957.1| COLlagen family member (col-102) [Caenorhabditis elegans] 1.0E-49
blast CAE73736 Hypothetical protein CBG21262 [Caenorhabditis briggsae] 6.0E-39
blast CAE73738 Hypothetical protein CBG21264 [Caenorhabditis briggsae] 1.0E-12
Protein Domains
Database ID Description E-Value
scop a.3.1.monodomain cytochrome c All alpha proteins; Cytochrome c; Cytochrome c; monodomain cytochrome c 7.59999990463257
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 2.8E-14
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.6E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.2E-6
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_499957.1 1 7-29
C18H7.3 1 7-29
SNAP00000042867 1 7-29
GENEFINDER00000042874 1 7-29
Sequence
Target Sequence
>C. ELEGANS:172802_X_AT
gagatgctggagctgatggtgccccaggaactgacgctgcatattgtccatgtccaccaa
gatccgctgctcttggagccggtggtggcgctgagccagccggagccgccccagaagctg
ctgccgctgccccagaagccgcaccagaagccgcaccagccgctgaaggagccggaggag
gagctgagccagcaggagccgccgcgcccgatgctgctgctgctgccccagaagccgccc
cagctgaagcagcaccagccgctgaaggagccggaggaggagctgagccagcaggagccg
cgcccgatgctgctgctgctgccccagaagccgccccagctgaagcagcaccagccgccg
aaggagccggaggaggagccgagccagctggagccgctgctccagatgccgccgccgccg
caccagaagctgctgccgccccagaagccgcaccagctgccgaaggagccggaggaggag
cagagccagccggagctgccccagaagccgccgccgcagccccagaaggagccggaggag
gt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAGATGCTGGAGCTGATGGTGCCCC 581 395 782 Antisense
CCCCAGGAACTGACGCTGCATATTG 116 261 803 Antisense
CTGACGCTGCATATTGTCCATGTCC 113 239 812 Antisense
CCAAGATCCGCTGCTCTTGGAGCCG 116 277 838 Antisense
CACCAGCCGCTGAAGGAGCCGGAGG 235 201 935 Antisense
GGAGGAGCTGAGCCAGCAGGAGCCG 561 515 958 Antisense
AAGCAGCACCAGCCGCTGAAGGAGC 264 151 1028 Antisense
AGCCGCCGAAGGAGCCGGAGGAGGA 30 83 1134 Antisense
ACCAGCTGCCGAAGGAGCCGGAGGA 14 85 1233 Antisense
GCCGGAGGAGGAGCAGAGCCAGCCG 357 283 1249 Antisense
AGCCCCAGAAGGAGCCGGAGGAGGT 29 83 1299 Antisense
Sequence Source Affymetrix Proprietary Database