[Home] | [Total List]

[172729_x_at] collagen

Description F11G11.12 /REP_DB=WormBase Gene ID /WP=CE09354 /TR=P91250 /GB=AAB37843.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=collagen
Cluster 6grp_highest_10_10 > 18      6grp_high1_10_10 > 80      4grp_highest_8_8 > 02      4grp_high_8_8 > 54      6grp_highest_nonorm > 29      6grp_total > 72      4grp_total > 57      6grp_highest_sub > 04_05      6grp_cgc > 75      6grp_high1_sub > 02_03_04_05      6grp_cgc_sub > 03_04      6grp_total_sub > Hat      6grp_rule_based > S5      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/172729_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 31846
1 2 3 4 range
A 1851.6
(-2.7)
P
24677.5
(1.6)
P
32017.3
(3)
P
171.8
(-3)
P
31846
B 1698
(-2.7)
P
28698.3
(2.7)
P
30258.8
(3)
P
172.9
(-3)
P
30086
C 1909.3
(-2.6)
P
23125.3
(3)
P
22200.2
(2.8)
P
543.1
(-3)
P
22582
avr 1819.6
(-2.7)
25500.4
(2.4)
28158.8
(3)
295.9
(-3)
27863

Warning: fopen(./gnuplot/172729_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 18312
1 2 3 4 5 6 range
A 4080.1
(-3)
P
16936
(2)
P
15845.2
(1.6)
P
19572.2
(3)
P
19049.1
(2.8)
P
12158.1
(0.1)
P
15492
B 3793.2
(-3)
P
15558.6
(2)
P
17815.1
(3)
P
16038.5
(2.2)
P
17438.7
(2.8)
P
10134.5
(-0.3)
P
14022
C 3780.2
(-3)
P
16162.6
(1.1)
P
18906.6
(2)
P
18583.6
(1.9)
P
22092.3
(3)
P
8426.8
(-1.5)
P
18312
avr 3884.5
(-3)
16219.1
(1.7)
17522.3
(2.2)
18064.8
(2.4)
19526.7
(3)
10239.8
(-0.6)
15642
No Scale

Warning: fopen(./gnuplot/172729_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8345
1 2 3 4 range
A 674.2
(-2.5)
P
5356.8
(0.8)
P
8370
(3)
P
25.2
(-3)
P
8345
B 541.5
(-2.6)
P
7087.8
(3)
P
7011.7
(2.9)
P
36.9
(-3)
P
7051
C 632
(-2.6)
P
6648.7
(2.1)
P
7737.5
(3)
P
91.6
(-3)
P
7646
avr 615.9
(-2.6)
6364.4
(1.9)
7706.4
(3)
51.2
(-3)
7655

Warning: fopen(./gnuplot/172729_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172729_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 6397
1 2 3 4 5 6 range
A 752.1
(-3)
P
6023.3
(3)
P
3450.8
(0.1)
P
4964
(1.8)
P
5748.2
(2.7)
P
2960.1
(-0.5)
P
5271
B 1319.8
(-3)
P
5178.8
(1)
P
4326
(0.1)
P
4248
(0)
P
7085.1
(3)
P
3779.1
(-0.4)
P
5765
C 1401.1
(-3)
P
4931.7
(0.7)
P
4812.1
(0.6)
P
3737.2
(-0.6)
P
7148.8
(3)
P
2820.9
(-1.5)
P
5748
avr 1157.7
(-3)
5377.9
(1.6)
4196.3
(0.3)
4316.4
(0.4)
6660.7
(3)
3186.7
(-0.8)
5503
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172729_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5407
Sequence Type Exemplar sequence
Representative Public ID F11G11.12 NCBI
Target Description F11G11.12 /REP_DB=WormBase Gene ID /WP=CE09354 /TR=P91250 /GB=AAB37843.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062479(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062479 NCBI Caenorhabditis elegans F11G11.12 (collagen) mRNA, complete cds. 11/11 None
SNAP00000005486 ENSEMBL cdna:SNAP chromosome:CEL140:II:4872203:4873112:-1 11/11 None
GENEFINDER00000005502 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:4872203:4873112:-1 11/11 None
F11G11.12 ENSEMBL cdna:known chromosome:CEL140:II:4872082:4873113:-1 gene:F11G11.12 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_181982 1/11 Cross Hyb Matching Probes None
NM_077291 1/11 Cross Hyb Matching Probes None
NM_068749 1/11 Cross Hyb Matching Probes A 
NM_058705 1/11 Cross Hyb Matching Probes A 
NM_001029722 1/11 Cross Hyb Matching Probes None
NM_001029723 1/11 Cross Hyb Matching Probes None
NM_076658 1/11 Cross Hyb Matching Probes A 
NM_076659 1/11 Cross Hyb Matching Probes A 
NM_067302 1/11 Cross Hyb Matching Probes A 
NM_077469 1/11 Cross Hyb Matching Probes A 
NM_063409 1/11 Cross Hyb Matching Probes A 
NM_072334 1/11 Cross Hyb Matching Probes A 
NM_077154 1/11 Cross Hyb Matching Probes A 
NM_063457 1/11 Cross Hyb Matching Probes A 
NM_058278 1/11 Cross Hyb Matching Probes A 
NM_062477 4/11 Cross Hyb Matching Probes A 
SNAP00000020922 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020931 1/11 Cross Hyb Matching Probes None
GENEFINDER00000044434 1/11 Cross Hyb Matching Probes None
SNAP00000044426 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035328 1/11 Cross Hyb Matching Probes None
SNAP00000035323 1/11 Cross Hyb Matching Probes None
SNAP00000005484 4/11 Cross Hyb Matching Probes None
GENEFINDER00000005492 4/11 Cross Hyb Matching Probes None
SNAP00000013421 1/11 Cross Hyb Matching Probes None
GENEFINDER00000013453 1/11 Cross Hyb Matching Probes None
SNAP00000025609 1/11 Cross Hyb Matching Probes None
GENEFINDER00000025627 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036401 1/11 Cross Hyb Matching Probes None
SNAP00000036391 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036400 1/11 Cross Hyb Matching Probes None
SNAP00000036392 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036395 1/11 Cross Hyb Matching Probes None
SNAP00000034887 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034916 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000294 1/11 Cross Hyb Matching Probes None
SNAP00000033329 1/11 Cross Hyb Matching Probes None
GENEFINDER00000033337 1/11 Cross Hyb Matching Probes None
SNAP00000035387 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035400 1/11 Cross Hyb Matching Probes None
SNAP00000029183 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029193 1/11 Cross Hyb Matching Probes None
SNAP00000029184 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029190 1/11 Cross Hyb Matching Probes None
SNAP00000004400 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004419 1/11 Cross Hyb Matching Probes None
SNAP00000004401 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004417 1/11 Cross Hyb Matching Probes None
SNAP00000036132 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036148 1/11 Cross Hyb Matching Probes None
SNAP00000003213 1/11 Cross Hyb Matching Probes None
GENEFINDER00000003228 1/11 Cross Hyb Matching Probes None
F53G12.7 1/11 Cross Hyb Matching Probes A 
K09H9.3 1/11 Cross Hyb Matching Probes A 
F11G11.10 4/11 Cross Hyb Matching Probes A 
F54C9.4 1/11 Cross Hyb Matching Probes A 
T01B7.7 1/11 Cross Hyb Matching Probes A 
Y41C4A.19 1/11 Cross Hyb Matching Probes None
F14F7.1.2 1/11 Cross Hyb Matching Probes A 
F14F7.1.1 1/11 Cross Hyb Matching Probes A 
F14F7.1.3 1/11 Cross Hyb Matching Probes A 
D2024.8 1/11 Cross Hyb Matching Probes A 
T15B7.5 1/11 Cross Hyb Matching Probes A 
T07H6.3a 1/11 Cross Hyb Matching Probes A 
T07H6.3b.3 1/11 Cross Hyb Matching Probes None
T07H6.3b.2 1/11 Cross Hyb Matching Probes A 
T10E10.2.1 1/11 Cross Hyb Matching Probes A 
T10E10.1 1/11 Cross Hyb Matching Probes A 
C35B8.1 1/11 Cross Hyb Matching Probes A 
ZC373.7 1/11 Cross Hyb Matching Probes A 
C34F6.3 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4872200-4873110(-) 93.47 100.0
chrII:4866707-4867532(-) 81.93 91.84
Public Domain and Genome References
Gene Title collagen
Gene Symbol col-73
Ensembl F11G11.12
Entrez Gene 184366 Entrez gene
SwissProt P91250 EMBL-EBI
WormBase CE09354 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast NP_494880 F11G11.12 [Caenorhabditis elegans] gb|AAB37843.1| Collagen protein 73 [Caenorhabditis elegans] 2.0E-66
blast CAE56956 Hypothetical protein CBG24806 [Caenorhabditis briggsae] 7.0E-65
blast CAB50767 putative cuticular collagen protein [Ascaris suum] emb|CAB85465.1| putative cuticular collagen [Ascaris suum] 5.0E-35
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 3.2E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 8.8E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-12
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 6.3E-14
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_494880.1 1 20-42
F11G11.12 1 20-42
SNAP00000005486 1 20-42
GENEFINDER00000005502 1 20-42
Sequence
Target Sequence
>C. ELEGANS:172729_X_AT
gaagcgtcaaacctaccaatgctgctcttgcggaattggaccagctggatccgttggaaa
cccaggacaagacggagccccaggaaatgacggaagaccaggagccccaggagccccagg
accagatgctccaaatgagcacgttcaaccaactccagccgatttctgcttcgagtgccc
accaggaccagccggaaacgccggaaacccaggaccaaagggaccaccaggacagccagg
agcaccaggagagcaaggaccaaatggacgcccaggagccccaggagccccaggaccaca
aggaccaccaggaaccgcaggaaatgacggaactccaggacaaccaggagcccccggaca
agtccgcaccgtcccagccccaccaggtaacccaggacagccaggagagccaggagccca
aggaccaccaggagaggatggacgcccaggaaactcaggaccacaaggaccaccaggacc
acaaggagagccaggacaagatggagctccaggaaacccaggagcaccaggagaggctgg
agagccaggaaaggacggagccaagggaggatgcgat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAAGCGTCAAACCTACCAATGCTGC 380 343 258 Antisense
ATGCTGCTCTTGCGGAATTGGACCA 351 41 276 Antisense
GGACCAGCTGGATCCGTTGGAAACC 322 523 295 Antisense
AATGACGGAAGACCAGGAGCCCCAG 136 163 343 Antisense
AATGAGCACGTTCAACCAACTCCAG 671 161 391 Antisense
GGACCAAAGGGACCACCAGGACAGC 8 523 469 Antisense
ACCACCAGGAACCGCAGGAAATGAC 482 85 561 Antisense
GTAACCCAGGACAGCCAGGAGAGCC 192 463 644 Antisense
GATGGACGCCCAGGAAACTCAGGAC 561 405 694 Antisense
GGACCACCAGGACCACAAGGAGAGC 403 523 724 Antisense
GGACGGAGCCAAGGGAGGATGCGAT 360 511 810 Antisense
Sequence Source Affymetrix Proprietary Database