[Home] | [Total List]

[172709_x_at] collagen

Description T06E4.4 /REP_DB=WormBase Gene ID /WP=CE06370 /TR=Q22256 /GB=CAA94788.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster 6grp_highest_10_10 > 34      6grp_high1_10_10 > 42      4grp_highest_8_8 > 09      4grp_high_8_8 > 53      6grp_highest_nonorm > 09      6grp_total > 30      4grp_total > 59      6grp_highest_sub > 02_03      6grp_cgc > 73      6grp_high1_sub > 02_03      6grp_cgc_sub > 02_03      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/172709_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 ¢Õ33082
1 2 3 4 range
A 15928.6
(-0.2)
P 		33572.7
(3)
P 		31246.8
(2.6)
P 		491.2
(-3)
P 		33082
B 17288.4
(0.5)
P 		26629.3
(2.4)
P 		29370.5
(3)
P 		502.2
(-3)
P 		28868
C 14710.5
(0.2)
P 		27129.2
(3)
P 		24675.5
(2.4)
P 		560.8
(-3)
P 		26568
avr 15975.8
(0.2) 		29110.4
(3) 		28430.9
(2.9) 		518.1
(-3) 		28592

Warning: fopen(./gnuplot/172709_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 ¢Õ28263
1 2 3 4 5 6 range
A 22036.1
(0.6)
P 		29940.6
(2.9)
P 		30292
(3)
P 		27092.7
(2.1)
P 		15524.5
(-1.2)
P 		9379.3
(-3)
P 		20913
B 14746.5
(-1.2)
P 		29274
(2.3)
P 		32255.6
(3)
P 		21162.2
(0.3)
P 		14750.6
(-1.2)
P 		7163.6
(-3)
P 		25092
C 17174.1
(-0.5)
P 		30157.2
(2.3)
P 		33449.2
(3)
P 		25922.3
(1.4)
P 		17283.5
(-0.4)
P 		5186
(-3)
P 		28263
avr 17985.6
(-0.4) 		29790.6
(2.5) 		31998.9
(3) 		24725.7
(1.2) 		15852.9
(-0.9) 		7243
(-3) 		24756
No Scale

Warning: fopen(./gnuplot/172709_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 ¢Õ8528
1 2 3 4 range
A 5799.6
(1.2)
P 		7287.7
(2.3)
P 		8168.5
(3)
P 		71.9
(-3)
P 		8097
B 5513.1
(1.8)
P 		6576.8
(2.8)
P 		6805.8
(3)
P 		107
(-3)
P 		6699
C 4869.6
(0.4)
P 		7799.8
(2.4)
P 		8600.2
(3)
P 		94.6
(-3)
P 		8506
avr 5394.1
(1.1) 		7221.4
(2.5) 		7858.2
(3) 		91.2
(-3) 		7767

Warning: fopen(./gnuplot/172709_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172709_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 ¢Õ8912
1 2 3 4 5 6 range
A 4062.2
(-1.7)
P 		10648.4
(3)
P 		6596.9
(0.1)
P 		6871.3
(0.3)
P 		4684.6
(-1.3)
P 		2283.6
(-3)
P 		8365
B 5131.1
(-0.9)
P 		9744.1
(3)
P 		7832.6
(1.4)
P 		5605.1
(-0.5)
P 		5993
(-0.2)
P 		2671.3
(-3)
P 		7073
C 6365.7
(0.7)
P 		9201.9
(3)
P 		8513.4
(2.4)
P 		5213
(-0.2)
P 		5592.7
(0.1)
P 		1736.1
(-3)
P 		7466
avr 5186.3
(-0.7) 		9864.8
(3) 		7647.6
(1.3) 		5896.5
(-0.1) 		5423.4
(-0.5) 		2230.3
(-3) 		7634
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172709_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.11758
Sequence Type Exemplar sequence
Representative Public ID T06E4.4 NCBI
Target Description T06E4.4 /REP_DB=WormBase Gene ID /WP=CE06370 /TR=Q22256 /GB=CAA94788.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073085(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_073085 NCBI Caenorhabditis elegans T06E4.4 (collagen) mRNA, complete cds. 11/11 A 
SNAP00000007442 ENSEMBL cdna:SNAP chromosome:CEL140:V:9634906:9635910:-1 11/11 None
GENEFINDER00000007459 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:9634906:9635910:-1 11/11 None
T06E4.4 ENSEMBL cdna:known chromosome:CEL140:V:9634855:9635921:-1 gene:T06E4.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_067008 1/11 Cross Hyb Matching Probes A 
NM_067009 1/11 Cross Hyb Matching Probes A 
NM_073276 1/11 Cross Hyb Matching Probes A 
NM_073277 1/11 Cross Hyb Matching Probes A 
NM_069896 1/11 Cross Hyb Matching Probes A 
NM_071851 1/11 Cross Hyb Matching Probes A 
NM_073512 1/11 Cross Hyb Matching Probes A 
NM_070299 1/11 Cross Hyb Matching Probes A 
NM_069971 1/11 Cross Hyb Matching Probes A 
NM_073083 6/11 Cross Hyb Matching Probes A 
NM_063358 1/11 Cross Hyb Matching Probes A 
NM_073882 1/11 Cross Hyb Matching Probes A 
NM_073883 1/11 Cross Hyb Matching Probes A 
NM_067669 1/11 Cross Hyb Matching Probes A 
NM_073899 1/11 Cross Hyb Matching Probes A 
NM_073933 1/11 Cross Hyb Matching Probes A 
NM_072334 1/11 Cross Hyb Matching Probes A 
NM_067007 1/11 Cross Hyb Matching Probes A 
NM_069714 1/11 Cross Hyb Matching Probes A 
NM_069715 1/11 Cross Hyb Matching Probes A 
NM_063908 1/11 Cross Hyb Matching Probes A 
SNAP00000004358 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004367 1/11 Cross Hyb Matching Probes None
SNAP00000014220 1/11 Cross Hyb Matching Probes None
GENEFINDER00000014231 1/11 Cross Hyb Matching Probes None
SNAP00000036390 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036401 1/11 Cross Hyb Matching Probes None
SNAP00000036391 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036400 1/11 Cross Hyb Matching Probes None
SNAP00000036392 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036395 1/11 Cross Hyb Matching Probes None
SNAP00000005950 1/11 Cross Hyb Matching Probes None
SNAP00000005951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005959 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005960 1/11 Cross Hyb Matching Probes None
SNAP00000017981 1/11 Cross Hyb Matching Probes None
GENEFINDER00000017990 1/11 Cross Hyb Matching Probes None
SNAP00000023282 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023293 1/11 Cross Hyb Matching Probes None
SNAP00000035582 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035589 1/11 Cross Hyb Matching Probes None
SNAP00000043808 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043818 1/11 Cross Hyb Matching Probes None
SNAP00000002816 1/11 Cross Hyb Matching Probes None
SNAP00000002817 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002822 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002824 1/11 Cross Hyb Matching Probes None
SNAP00000007051 1/11 Cross Hyb Matching Probes None
SNAP00000007052 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007058 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007063 1/11 Cross Hyb Matching Probes None
SNAP00000007440 6/11 Cross Hyb Matching Probes None
GENEFINDER00000007452 6/11 Cross Hyb Matching Probes None
SNAP00000011265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011290 1/11 Cross Hyb Matching Probes None
SNAP00000011428 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011431 1/11 Cross Hyb Matching Probes None
SNAP00000013927 1/11 Cross Hyb Matching Probes None
GENEFINDER00000013944 1/11 Cross Hyb Matching Probes None
SNAP00000020011 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020025 1/11 Cross Hyb Matching Probes None
SNAP00000023063 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 1/11 Cross Hyb Matching Probes None
SNAP00000035387 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035400 1/11 Cross Hyb Matching Probes None
M195.1 1/11 Cross Hyb Matching Probes A 
C09G5.4 1/11 Cross Hyb Matching Probes A 
W05B2.6 1/11 Cross Hyb Matching Probes A 
W05B2.5 1/11 Cross Hyb Matching Probes A 
W05B2.1 1/11 Cross Hyb Matching Probes A 
F58F6.1 1/11 Cross Hyb Matching Probes A 
F54D1.2 1/11 Cross Hyb Matching Probes R A 
F54D1.3 1/11 Cross Hyb Matching Probes R A 
M18.1 1/11 Cross Hyb Matching Probes A 
F08G5.4 1/11 Cross Hyb Matching Probes A 
F52B11.4 1/11 Cross Hyb Matching Probes A 
F41F3.4 1/11 Cross Hyb Matching Probes A 
T15B7.5 1/11 Cross Hyb Matching Probes A 
T06E4.6 6/11 Cross Hyb Matching Probes A 
F15H10.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.1 1/11 Cross Hyb Matching Probes A 
T11F9.9 1/11 Cross Hyb Matching Probes R A 
F57B1.3 1/11 Cross Hyb Matching Probes A 
F57B1.4.1 1/11 Cross Hyb Matching Probes A 
F57B1.4.3 1/11 Cross Hyb Matching Probes None
F57B1.4.2 1/11 Cross Hyb Matching Probes A 
C50B6.4 1/11 Cross Hyb Matching Probes A 
Y2H9A.3 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:9632547-9633504(+) 86.94 90.26
chrV:9634905-9635910(-) 100.0 100.0
Public Domain and Genome References
Gene Title collagen
Gene Symbol col-147
Ensembl T06E4.4
Entrez Gene 179351 Entrez gene
SwissProt Q22256 EMBL-EBI
WormBase CE06370 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA94788 Hypothetical protein T06E4.4 [Caenorhabditis elegans] ref|NP_505486.1| T06E4.4 [Caenorhabditis elegans] 7.0E-50
blast CAA94792 Hypothetical protein T06E4.6 [Caenorhabditis elegans] ref|NP_505484.1| T06E4.6 [Caenorhabditis elegans] 2.0E-49
blast CAE72217 Hypothetical protein CBG19328 [Caenorhabditis briggsae] 4.0E-47
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 1.1E-25
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.4E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.9E-10
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_505486.1 1 5-27
T06E4.4 1 5-27
SNAP00000007442 1 5-27
GENEFINDER00000007459 1 5-27
Sequence
Target Sequence 
>C. ELEGANS:172709_X_AT
ccaggccaaccaggagctcaaggagaggctggacacgctggagaggctggaaagccagga
gccaacggagttaccatcggacttaccggaggaaatggaccatgtatcacttgcccagct
ggagccccaggaccagccggagctcctggagcaccaggaccacaaggaccatctggagcc
ccaggacaagacgctgttggaggaggaccagggccagctggaccacagggaccagccgga
gatgccggagctccaggacaagccggagcaccaggacatccaggagccccaggacaagga
ggacaacgcagccgtggaactccaggaccatctggagctccaggaccacaaggaccagcc
ggaggaccaggacagccaggacaatccggaggagccggagccccaggaccagctggagct
ccaggagcaccaggaggaccaggaaacgcgggaaccccaggaaccccaggagcaccagga
aacgctggagcaccaggaggagacgccgcatattgtcca

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CCAGGCCAACCAGGAGCTCAAGGAG 501 271 292 Antisense
AGCCAACGGAGTTACCATCGGACTT 510 81 351 Antisense
GAAATGGACCATGTATCACTTGCCC 460 361 383 Antisense
GGACCACAAGGACCATCTGGAGCCC 367 523 448 Antisense
AGCCCCAGGACAAGACGCTGTTGGA 487 83 468 Antisense
GGACCAGCCGGAGATGCCGGAGCTC 407 523 520 Antisense
GCCGTGGAACTCCAGGACCATCTGG 152 283 602 Antisense
TCTGGAGCTCCAGGACCACAAGGAC 592 607 622 Antisense
GAGGACCAGGACAGCCAGGACAATC 529 403 653 Antisense
GGACCAGCTGGAGCTCCAGGAGCAC 314 523 697 Antisense
AGGAGGAGACGCCGCATATTGTCCA 302 57 786 Antisense
Sequence Source Affymetrix Proprietary Database