[Home] | [Total List]

[172615_x_at] cyclin

Description H31G24.4 /REP_DB=WormBase Gene ID /WP=CE23835 /GB=AAK21417.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation /DEF=cyclin
Cluster 6grp_highest_10_10 > 88      6grp_high1_10_10 > 88      4grp_highest_8_8 > 07      4grp_high_8_8 > 21      6grp_highest_nonorm > 99      6grp_total > 98      4grp_total > 11      6grp_highest_sub > Da      6grp_cgc > 69      6grp_high1_sub > Da      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/172615_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 174
1 2 3 4 range
A 83.1
(-2)
P
83.8
(-1.9)
P
54.1
(-3)
P
222.9
(3)
P
169
B 78.6
(-2.3)
P
124.6
(0.5)
P
66.9
(-3)
P
166.1
(3)
P
99
C 80.6
(-2.6)
P
94.6
(-2.1)
P
71.2
(-3)
P
228.3
(3)
P
157
avr 80.8
(-2.3)
101
(-1.4)
64.1
(-3)
205.8
(3)
142

Warning: fopen(./gnuplot/172615_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2290
1 2 3 4 5 6 range
A 115.7
(-2.9)
P
87.4
(-3)
P
104.4
(-3)
P
259.3
(-2.5)
P
1329.8
(0.4)
P
2280
(3)
P
2193
B 78.9
(-3)
P
128.8
(-2.9)
P
107.2
(-2.9)
P
283.2
(-2.5)
P
1354.1
(0.4)
P
2360.1
(3)
P
2281
C 70.1
(-3)
P
92.5
(-2.9)
P
81.7
(-3)
P
262.3
(-2.5)
P
1691
(1.5)
P
2244.5
(3)
P
2174
avr 88.2
(-3)
102.9
(-3)
97.8
(-3)
268.3
(-2.5)
1458.3
(0.7)
2294.9
(3)
2207
No Scale

Warning: fopen(./gnuplot/172615_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 24
1 2 3 4 range
A 30.3
(2.3)
P
18.2
(-1.7)
P
14.2
(-3)
P
32.6
(3)
P
18
B 25.1
(-0.1)
P
30.8
(1.6)
P
15.5
(-3)
P
35.4
(3)
P
20
C 26.7
(-2.2)
P
27.2
(-1.9)
P
24.8
(-3)
P
38.5
(3)
P
14
avr 27.4
(0.2)
25.4
(-0.5)
18.2
(-3)
35.5
(3)
17

Warning: fopen(./gnuplot/172615_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172615_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 859
1 2 3 4 5 6 range
A 21.3
(-3)
P
31.1
(-2.9)
P
22.7
(-3)
P
65.8
(-2.5)
P
401.3
(1.3)
P
555.1
(3)
P
534
B 27.5
(-3)
P
42.9
(-2.9)
P
26
(-3)
P
75
(-2.7)
P
550.2
(0.7)
P
880.1
(3)
P
854
C 26
(-3)
P
28.2
(-2.9)
P
20.8
(-3)
P
52.7
(-2.7)
P
547.2
(1.3)
P
751.4
(3)
P
731
avr 24.9
(-3)
34.1
(-2.9)
23.2
(-3)
64.5
(-2.6)
499.6
(1.1)
728.9
(3)
706
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172615_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1027
Sequence Type Exemplar sequence
Representative Public ID H31G24.4 NCBI
Target Description H31G24.4 /REP_DB=WormBase Gene ID /WP=CE23835 /GB=AAK21417.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation /DEF=cyclin
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_058896(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_058896 NCBI Caenorhabditis elegans H31G24.4 (cyclin) mRNA, complete cds. 11/11 A 
SNAP00000031638 ENSEMBL cdna:SNAP chromosome:CEL140:I:4114879:4116074:1 11/11 None
GENEFINDER00000031646 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:4114879:4116074:1 11/11 None
H31G24.4 ENSEMBL cdna:known chromosome:CEL140:I:4114862:4116305:1 gene:H31G24.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_069646 7/11 Cross Hyb Matching Probes A 
SNAP00000002298 7/11 Cross Hyb Matching Probes None
GENEFINDER00000002300 7/11 Cross Hyb Matching Probes None
Y43E12A.1 7/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:4114878-4116074(+) 100.0 100.0
Public Domain and Genome References
Gene Title cyclin
Gene Symbol cyb-2.2
Ensembl H31G24.4
Entrez Gene 171993 Entrez gene
SwissProt Q9BLB5 EMBL-EBI
WormBase CE23835 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:17116_AT cyclin 1b (CYC1b) at
ATH1-121501:261159_S_AT cyclin, putative at
YEAST_2:1772627_AT B-type cyclin involved in cell cycle progression; activates Cdc28p to promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin-mediated degradation Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
74 regulation of progression through cell cycle inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK21417 Cyclin b protein 2.2 [Caenorhabditis elegans] ref|NP_491297.1| H31G24.4 [Caenorhabditis elegans] 0.0
blast CAA15975 Hypothetical protein Y43E12A.1 [Caenorhabditis elegans] ref|NP_502047.1| CYclin B family member (cyb-2.1) [Caenorhabditis elegans] 1.0E-162
blast CAA94384 Hypothetical protein ZC168.4 [Caenorhabditis elegans] ref|NP_501987.1| ZC168.4 [Caenorhabditis elegans] sp|Q10653|CCNB1_CAEEL G2/mitotic-specific cyclin B1 gb|AAA84394.1| cyclin B 1.0E-114
Protein Domains
Database ID Description E-Value
Pfam IPR004367 EMBL-EBI Cyclin, C-terminal 2.5E-22
Pfam IPR006671 EMBL-EBI Cyclin, N-terminal domain 1.0E-52
Sequence
Target Sequence
>C. ELEGANS:172615_X_AT
ttacttgccagacatcctcgaatacgagttgatcactgagaacacattcagcaagaagca
gatattggctatggaacagaccatcctcaacgccttgaactttgacttgtcctgcccatc
ttcgcttgtcttcctccgttatatctcaaaaactctcacagagaatgacgtcaatccaat
cgataaggaaacgttctattatgtgcacaatatctccaagtgtctcggagaactcgcatt
gctcgattcggtcatgtctacggttccaaggtcgcacgttgctagtgcttcgatgatcat
cactctcaatattatctccgttgatggaattaatccgaagactgctgcatcgatgattcg
caaacaattcggagcctccaagcaagatatttatgatgctatctctctgctcgctcaagt
cgcatataaaaacttcagacatcagaagctttgcgccattagggaaaagtaccagtccag
caagtttggacgagtatcctacttgatgaccgacga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TTACTTGCCAGACATCCTCGAATAC 544 679 444 Antisense
AACGCCTTGAACTTTGACTTGTCCT 331 145 532 Antisense
GAGAACTCGCATTGCTCGATTCGGT 573 391 671 Antisense
TCGATTCGGTCATGTCTACGGTTCC 232 603 686 Antisense
AAGGTCGCACGTTGCTAGTGCTTCG 330 159 711 Antisense
ATCATCACTCTCAATATTATCTCCG 183 31 739 Antisense
GATTCGCAAACAATTCGGAGCCTCC 309 433 798 Antisense
ATTTATGATGCTATCTCTCTGCTCG 694 15 832 Antisense
CTCTGCTCGCTCAAGTCGCATATAA 659 231 848 Antisense
GACATCAGAAGCTTTGCGCCATTAG 22 371 881 Antisense
GAGTATCCTACTTGATGACCGACGA 101 399 935 Antisense
Sequence Source Affymetrix Proprietary Database