[Home] | [Total List]

[172610_x_at]

Description ZC239.14 /REP_DB=WormBase Gene ID /WP=CE15136 /TR=P91561 /GB=AAB37956.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 80      4grp_total > 08      6grp_total_sub > Hat      6grp_rule_based > S4      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172610_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 43
1 2 3 4 range
A 9.5
(-2.8)
A
8.4
(-3)
A
31.3
(0.3)
A
49.7
(3)
A
41
B 9.3
(-2.6)
A
7.2
(-3)
A
7
(-3)
A
37.8
(3)
A
31
C 16.2
(-2.3)
A
18.8
(-1.8)
A
12.3
(-3)
A
44.2
(3)
P
32
avr 11.7
(-3)
11.5
(-3)
16.9
(-2)
43.9
(3)
32

Warning: fopen(./gnuplot/172610_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 184
1 2 3 4 5 6 range
A 23.7
(-2.5)
A
10.1
(-3)
A
63.9
(-1)
A
175.2
(3)
P
81.2
(-0.4)
P
50.4
(-1.5)
A
165
B 17.2
(-2.8)
A
35.6
(-2.2)
A
31.9
(-2.4)
A
191.5
(3)
P
115.6
(0.5)
P
12.7
(-3)
A
179
C 7.3
(-3)
A
37.2
(-1.8)
A
45.8
(-1.5)
A
158.6
(3)
P
128.4
(1.8)
P
70.9
(-0.5)
P
151
avr 16.1
(-3)
27.6
(-2.6)
47.2
(-1.8)
175.1
(3)
108.4
(0.5)
44.7
(-1.9)
159
No Scale

Warning: fopen(./gnuplot/172610_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 7
1 2 3 4 range
A 3.5
(-1.4)
A
1.8
(-3)
A
8.2
(3)
A
7.3
(2.2)
A
6
B 3
(-1.7)
A
1.8
(-2.8)
A
1.6
(-3)
A
8
(3)
A
6
C 5.4
(-0.9)
A
5.4
(-0.9)
A
4.3
(-3)
A
7.5
(3)
P
3
avr 4
(-1.7)
3
(-3)
4.7
(-0.8)
7.6
(3)
5

Warning: fopen(./gnuplot/172610_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172610_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 48
1 2 3 4 5 6 range
A 4.4
(-2.9)
A
3.6
(-3)
A
13.9
(-1.5)
A
44.4
(3)
P
24.5
(0.1)
P
12.3
(-1.7)
A
41
B 6
(-2.8)
A
11.9
(-2.1)
A
7.7
(-2.6)
A
50.7
(3)
P
47
(2.5)
P
4.7
(-3)
A
46
C 2.7
(-3)
A
11.3
(-1.7)
A
11.7
(-1.6)
A
31.9
(1.5)
P
41.6
(3)
P
23.7
(0.2)
P
39
avr 4.4
(-3)
8.9
(-2.3)
11.1
(-1.9)
42.3
(3)
37.7
(2.3)
13.6
(-1.5)
38
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172610_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5565
Sequence Type Exemplar sequence
Representative Public ID ZC239.14 NCBI
Target Description ZC239.14 /REP_DB=WormBase Gene ID /WP=CE15136 /TR=P91561 /GB=AAB37956.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062078(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062078 NCBI Caenorhabditis elegans ZC239.14 (ZC239.14) mRNA, complete cds. 11/11 None
SNAP00000024298 ENSEMBL cdna:SNAP chromosome:CEL140:II:3221193:3222005:-1 11/11 None
GENEFINDER00000024304 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:3219820:3222005:-1 11/11 None
ZC239.14 ENSEMBL cdna:known chromosome:CEL140:II:3221389:3222005:-1 gene:ZC239.14 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:3221493-3222004(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl ZC239.14
Entrez Gene 191124 Entrez gene
SwissProt P91561 EMBL-EBI
WormBase CE29150 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6813 potassium ion transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
8076 voltage-gated potassium channel complex inferred from electronic annotation QuickGO AmiGO
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5249 voltage-gated potassium channel activity inferred from electronic annotation QuickGO AmiGO
5515 protein binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB37956 Hypothetical protein ZC239.14 [Caenorhabditis elegans] ref|NP_494479.1| ZC239.14 [Caenorhabditis elegans] 2.0E-95
blast AAB37956 Hypothetical protein ZC239.14 [Caenorhabditis elegans] ref|NP_494479.1| ZC239.14 [Caenorhabditis elegans] 8.0E-94
blast AAB37956 Hypothetical protein ZC239.14 [Caenorhabditis elegans] ref|NP_494479.1| ZC239.14 [Caenorhabditis elegans] 1.0E-93
blast AAB37955 Hypothetical protein ZC239.15 [Caenorhabditis elegans] ref|NP_494481.1| ZC239.15 [Caenorhabditis elegans] 1.0E-63
blast AAB37955 Hypothetical protein ZC239.15 [Caenorhabditis elegans] ref|NP_494481.1| ZC239.15 [Caenorhabditis elegans] 8.0E-62
blast AAB37955 Hypothetical protein ZC239.15 [Caenorhabditis elegans] ref|NP_494481.1| ZC239.15 [Caenorhabditis elegans] 1.0E-61
blast NP_494315 F22E5.8 [Caenorhabditis elegans] gb|AAB66174.2| Hypothetical protein F22E5.8 [Caenorhabditis elegans] 2.0E-58
Protein Domains
Database ID Description E-Value
Pfam IPR003131 EMBL-EBI K+ channel tetramerisation 1.9E-43
Sequence
Target Sequence
>C. ELEGANS:172610_X_AT
ggaatgcgacattgggctgaaactcgacgaatctggatgcatttttattgatcgctcccc
gaaacatttcgacttgatactgaatttcatgagagatggtgacgtggctctacccaattg
tgaactgaaattgaaggaactactagtagaagctcaattttatttgcttgacgggctaat
tgagatgtgcaattcaaaaataatgccagttgaacctccgaaactagttgggagaaaatt
tcagtttattgaaagcaatgcaaaattgcttcaaattcttgctgaccatcaaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGAATGCGACATTGGGCTGAAACTC 304 531 108 Antisense
GCTGAAACTCGACGAATCTGGATGC 193 297 123 Antisense
GATGCATTTTTATTGATCGCTCCCC 238 413 143 Antisense
ATCGCTCCCCGAAACATTTCGACTT 615 35 158 Antisense
GAGAGATGGTGACGTGGCTCTACCC 25 395 198 Antisense
TGGCTCTACCCAATTGTGAACTGAA 250 545 212 Antisense
AATTTTATTTGCTTGACGGGCTAAT 31 175 263 Antisense
GCTTGACGGGCTAATTGAGATGTGC 566 305 273 Antisense
AAATAATGCCAGTTGAACCTCCGAA 676 113 305 Antisense
GCCAGTTGAACCTCCGAAACTAGTT 227 241 312 Antisense
TTCAAATTCTTGCTGACCATCAAAA 562 685 377 Antisense
Sequence Source Affymetrix Proprietary Database