[Home] | [Total List]

[172608_x_at]

Description Y106G6G.5 /REP_DB=WormBase Gene ID /WP=CE23215 /TR=Q9XWA7 /GB=CAA22056.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 50      4grp_total > 35      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/172608_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 53
1 2 3 4 range
A 1.7
(-3)
A
31.1
(0.4)
A
7.9
(-2.3)
A
54
(3)
A
52
B 0.9
(-3)
A
35.1
(3)
A
4
(-2.5)
A
7.2
(-1.9)
A
34
C 18.9
(3)
A
16.6
(2.2)
A
2.4
(-3)
A
6.7
(-1.4)
A
17
avr 7.2
(-2.4)
27.6
(3)
4.8
(-3)
22.6
(1.7)
23

Warning: fopen(./gnuplot/172608_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 15
1 2 3 4 5 6 range
A 3.2
(-1.2)
A
2.3
(-2.3)
A
6.4
(3)
A
5.7
(2.1)
A
2.1
(-2.6)
A
1.8
(-3)
A
5
B 6.1
(-1.1)
A
7.1
(-0.6)
A
15.9
(3)
A
7.7
(-0.4)
A
2.9
(-2.4)
A
1.4
(-3)
A
15
C 3
(-1.4)
A
6.8
(1.6)
A
1.3
(-2.8)
A
8.6
(3)
A
1
(-3)
A
2.9
(-1.5)
A
8
avr 4.1
(-0.9)
5.4
(0.5)
7.9
(3)
7.3
(2.4)
2
(-3)
2
(-3)
6
No Scale

Warning: fopen(./gnuplot/172608_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8
1 2 3 4 range
A 0.6
(-3)
A
6.7
(2)
A
2.1
(-1.8)
A
7.9
(3)
A
7
B 0.3
(-3)
A
8.7
(3)
A
0.9
(-2.6)
A
1.5
(-2.1)
A
8
C 6.2
(3)
A
4.8
(1.4)
A
0.8
(-3)
A
1.1
(-2.7)
A
5
avr 2.4
(-1.8)
6.7
(3)
1.3
(-3)
3.5
(-0.6)
5

Warning: fopen(./gnuplot/172608_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172608_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4
1 2 3 4 5 6 range
A 0.6
(-1.8)
A
0.8
(-0.6)
A
1.4
(3)
A
1.4
(3)
A
0.6
(-1.8)
A
0.4
(-3)
A
1
B 2.1
(-0.2)
A
2.4
(0.4)
A
3.9
(3)
A
2
(-0.4)
A
1.2
(-1.8)
A
0.5
(-3)
A
3
C 1.1
(-0.3)
A
2.1
(3)
A
0.3
(-3)
A
1.7
(1.7)
A
0.3
(-3)
A
1
(-0.7)
A
2
avr 1.3
(0.2)
1.8
(2.5)
1.9
(3)
1.7
(2.1)
0.7
(-2.5)
0.6
(-3)
1
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172608_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1682
Sequence Type Exemplar sequence
Representative Public ID Y106G6G.5 NCBI
Target Description Y106G6G.5 /REP_DB=WormBase Gene ID /WP=CE23215 /TR=Q9XWA7 /GB=CAA22056.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060303(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060303 NCBI Caenorhabditis elegans Y106G6G.5 (Y106G6G.5) mRNA, complete cds. 11/11 None
GENEFINDER00000021086 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:10325494:10326141:1 11/11 None
SNAP00000021075 ENSEMBL cdna:SNAP chromosome:CEL140:I:10325593:10326141:1 10/11 None
Y106G6G.5 ENSEMBL cdna:known chromosome:CEL140:I:10324412:10326141:1 gene:Y106G6G.5 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_060890 2/11 Cross Hyb Matching Probes A 
SNAP00000013485 2/11 Cross Hyb Matching Probes None
Y26D4A.9 2/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:10324342-10326072(+) 98.28 100.0
chrI:13094733-13096512(-) 93.4 95.12
Public Domain and Genome References
Gene Title
Ensembl Y106G6G.5
Entrez Gene 190924 Entrez gene
SwissProt Q9XWA7 EMBL-EBI
WormBase CE23215 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
4867 serine-type endopeptidase inhibitor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA22056 Hypothetical protein Y106G6G.5 [Caenorhabditis elegans] ref|NP_492704.1| Y106G6G.5 [Caenorhabditis elegans] 0.0
blast CAB54347 Hypothetical protein Y26D4A.9 [Caenorhabditis elegans] ref|NP_493291.1| Y26D4A.9 [Caenorhabditis elegans] 0.0
blast CAE61411 Hypothetical protein CBG05275 [Caenorhabditis briggsae] 1.0E-162
blast CAA22056 Hypothetical protein Y106G6G.5 [Caenorhabditis elegans] ref|NP_492704.1| Y106G6G.5 [Caenorhabditis elegans] 1.0E-114
blast CAB54347 Hypothetical protein Y26D4A.9 [Caenorhabditis elegans] ref|NP_493291.1| Y26D4A.9 [Caenorhabditis elegans] 1.0E-107
blast CAA22056 Hypothetical protein Y106G6G.5 [Caenorhabditis elegans] ref|NP_492704.1| Y106G6G.5 [Caenorhabditis elegans] 4.0E-94
blast CAB54347 Hypothetical protein Y26D4A.9 [Caenorhabditis elegans] ref|NP_493291.1| Y26D4A.9 [Caenorhabditis elegans] 5.0E-88
Sequence
Target Sequence
>C. ELEGANS:172608_X_AT
aagccgttttatgttggaatgagtattttagatttgagtaagaatctaatgtatgatttt
cattataatgtaatggagcctaagtatggagatgatttgaagttgtgttatcaagacaca
gattctttcatctatgaaataaaaactgaggatgtttatgatgatatgaataatatgaaa
gaatggttcgatttttctgactatcctaaagaacattcactatatagtgatgagaataaa
aaggtaattgggaagtttaaggatgagttgagcgggaatataatgagtgaaatcgttgcc
ttccggccaaaacaatatgcttttagagtttctaaattaaatgattgtttggaggtggag
gttaagaaaaataaaggaataaaaaggagtgttgtaaagaaggaattaacttttgctgat
tataagaactgtttaattgatagaacggtttcaaggaagcagcaaatgttgataagctca
agcaaacatcaagttcattctgttcaacagaacaaagttgttctgaataacatgattgga
aaagatgtagaggctaaaagatacgttgttgacaatattcacacatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AAGCCGTTTTATGTTGGAATGAGTA 10 149 907 Antisense
CAAGACACAGATTCTTTCATCTATG 346 185 1018 Antisense
TGGTTCGATTTTTCTGACTATCCTA 513 551 1090 Antisense
GACTATCCTAAAGAACATTCACTAT 229 373 1105 Antisense
GTTTAAGGATGAGTTGAGCGGGAAT 1 447 1161 Antisense
AATGAGTGAAATCGTTGCCTTCCGG 53 165 1188 Antisense
TCGTTGCCTTCCGGCCAAAACAATA 630 603 1199 Antisense
GCCTTCCGGCCAAAACAATATGCTT 480 279 1204 Antisense
AACAATATGCTTTTAGAGTTTCTAA 93 135 1217 Antisense
ACATCAAGTTCATTCTGTTCAACAG 661 105 1392 Antisense
ACGTTGTTGACAATATTCACACATT 208 95 1469 Antisense
Sequence Source Affymetrix Proprietary Database