[Home] | [Total List]

[172487_x_at] transposase /// transposase /// transposase

Description Y54C5B.1 /REP_DB=WormBase Gene ID /WP=CE19627 /TR=O76723 /GB=AAC26957.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 26      4grp_total > 18      6grp_total_sub > Cup      

Scale

Warning: fopen(./gnuplot/172487_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 107
1 2 3 4 range
A 71.8
(1.1)
M
25.7
(-3)
A
63
(0.3)
A
93.5
(3)
A
68
B 23.1
(-1.9)
A
58.4
(3)
A
15.3
(-3)
A
24.9
(-1.7)
A
43
C 9.1
(-3)
A
50.1
(-0.7)
A
31.8
(-1.7)
A
115.6
(3)
P
107
avr 34.7
(-3)
44.7
(-1.6)
36.7
(-2.7)
78
(3)
43

Warning: fopen(./gnuplot/172487_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 50
1 2 3 4 5 6 range
A 16
(-0.7)
A
4.2
(-3)
A
28.4
(1.7)
A
5.3
(-2.8)
A
35.3
(3)
A
27.3
(1.5)
A
31
B 31.4
(0.5)
A
49.9
(3)
A
4.9
(-3)
A
6
(-2.9)
A
13
(-1.9)
A
6.5
(-2.8)
A
45
C 41.8
(1.5)
M
54.2
(3)
A
4.2
(-3)
A
5.1
(-2.9)
A
6
(-2.8)
A
4.2
(-3)
A
50
avr 29.7
(1.7)
36.1
(3)
12.5
(-1.6)
5.5
(-3)
18.1
(-0.5)
12.7
(-1.6)
31
No Scale

Warning: fopen(./gnuplot/172487_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 23
1 2 3 4 range
A 26.2
(3)
M
5.6
(-3)
A
16.5
(0.2)
A
13.7
(-0.6)
A
21
B 7.4
(-0.9)
A
14.4
(3)
A
3.6
(-3)
A
5.3
(-2.1)
A
11
C 3
(-3)
A
14.4
(1.1)
A
11.1
(-0.1)
A
19.5
(3)
P
17
avr 12.2
(1.5)
11.5
(-0.3)
10.4
(-3)
12.8
(3)
2

Warning: fopen(./gnuplot/172487_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172487_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 16
1 2 3 4 5 6 range
A 3
(-1.9)
A
1.5
(-2.9)
A
6.2
(0.1)
A
1.3
(-3)
A
10.7
(3)
A
6.6
(0.4)
A
9
B 10.9
(0.8)
A
16.6
(3)
A
1.2
(-3)
A
1.6
(-2.8)
A
5.3
(-1.4)
A
2.4
(-2.5)
A
15
C 15.5
(2.6)
M
16.5
(3)
A
1.1
(-3)
A
1
(-3)
A
1.9
(-2.7)
A
1.4
(-2.8)
A
16
avr 9.8
(2)
11.5
(3)
2.8
(-2.1)
1.3
(-3)
6
(-0.2)
3.5
(-1.7)
10
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172487_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5162
Sequence Type Exemplar sequence
Representative Public ID Y54C5B.1 NCBI
Target Description Y54C5B.1 /REP_DB=WormBase Gene ID /WP=CE19627 /TR=O76723 /GB=AAC26957.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069028(11), NM_062313(11), NM_001028286(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069028 NCBI Caenorhabditis elegans M116.3 (transposase) mRNA, complete cds. 11/11 A 
NM_062313 NCBI Caenorhabditis elegans Y54C5B.1 (transposase) mRNA, complete cds. 11/11 None
NM_001028286 NCBI Caenorhabditis elegans Y38F2AR.4 (transposase) mRNA, complete cds. 11/11 None
SNAP00000020140 ENSEMBL cdna:SNAP chromosome:CEL140:II:4051927:4053866:1 11/11 None
GENEFINDER00000020143 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:4051927:4053855:1 11/11 None
SNAP00000005094 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8400173:8403128:-1 11/11 None
GENEFINDER00000005100 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8400173:8403128:-1 11/11 None
SNAP00000010781 ENSEMBL cdna:SNAP chromosome:CEL140:IV:13294411:13296217:1 10/11 None
GENEFINDER00000010797 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:13294107:13296217:1 10/11 None
SNAP00000033663 ENSEMBL cdna:SNAP chromosome:CEL140:IV:2369011:2387919:1 11/11 None
GENEFINDER00000033680 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:2369011:2381940:1 11/11 None
Y54C5B.1 ENSEMBL cdna:known chromosome:CEL140:II:4051927:4053866:1 gene:Y54C5B.1 11/11 None
Y38F2AR.4 ENSEMBL cdna:known chromosome:CEL140:IV:2369011:2370950:1 gene:Y38F2AR.4 11/11 A 
M116.3 ENSEMBL cdna:known chromosome:CEL140:IV:8401189:8403128:-1 gene:M116.3 11/11 None
Y67H2A.3 ENSEMBL cdna:pseudogene chromosome:CEL140:IV:13294411:13296791:1 gene:Y67H2A.3 10/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000019073 8/11 Cross Hyb Matching Probes None
GENEFINDER00000019089 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Public Domain and Genome References
Gene Title transposase
transposase
transposase
Ensembl Y54C5B.1
Y38F2AR.4
M116.3
Y67H2A.3
Entrez Gene 177023 Entrez gene
190255 Entrez gene
191714 Entrez gene
SwissProt O44522 EMBL-EBI
Q27397 EMBL-EBI
O76723 EMBL-EBI
WormBase CE35344 Wormbase
CE37564 Wormbase
CE19627 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3676 nucleic acid binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB94140 Hypothetical protein M116.3 [Caenorhabditis elegans] ref|NP_501429.2| M116.3 [Caenorhabditis elegans] 0.0
blast CAA84584 putative transposase [Caenorhabditis elegans] ref|NP_001023457.1| Y38F2AR.4 [Caenorhabditis elegans] gb|AAA20582.1| putative transposase [Caenorhabditis elegans] gb|AAU87814.1| Hypothetical protein Y38F2AR.4 [Caenorhabditis elegans] 0.0
blast AAC26957 Hypothetical protein Y54C5B.1 [Caenorhabditis elegans] ref|NP_494714.1| Y54C5B.1 [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
scop a.4.1.Centromere-binding All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Centromere-binding 7.59999990463257
Pfam IPR004906 EMBL-EBI Tc5 transposase 1.0E-126
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 4.8E-39
Pfam IPR004875 EMBL-EBI CENP-B protein 2.6E-74
Pfam IPR004875 EMBL-EBI CENP-B protein 5.2E-76
Pfam IPR004875 EMBL-EBI CENP-B protein 1.5E-75
Pfam IPR004906 EMBL-EBI Tc5 transposase 2.5E-70
Pfam IPR004906 EMBL-EBI Tc5 transposase 2.3E-41
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 5.7E-39
Pfam IPR004875 EMBL-EBI CENP-B protein 5.2E-76
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 5.7E-39
Pfam IPR004906 EMBL-EBI Tc5 transposase 4.4E-43
Pfam IPR004906 EMBL-EBI Tc5 transposase 2.3E-41
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 4.8E-39
Pfam IPR004875 EMBL-EBI CENP-B protein 2.3E-8
Pfam IPR004875 EMBL-EBI CENP-B protein 1.3E-47
Pfam IPR004906 EMBL-EBI Tc5 transposase 1.0E-126
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 4.8E-39
Pfam IPR004875 EMBL-EBI CENP-B protein 2.3E-8
Pfam IPR004875 EMBL-EBI CENP-B protein 1.3E-47
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 4.8E-39
Pfam IPR004875 EMBL-EBI CENP-B protein 1.5E-75
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 2.2E-36
Pfam IPR007350 EMBL-EBI Tc5 transposase, C-terminal 2.0E-37
Pfam IPR004875 EMBL-EBI CENP-B protein 2.6E-74
Trans Membrane
ID Number Of Domains Domain Boundaries
SNAP00000033663 3 1221-1243,1281-1303,1327-1349
Sequence
Target Sequence
>C. ELEGANS:172487_X_AT
tgatcatccgagctaatacgtcccacattatgaataaacaactaatggtcgactgggttg
aatccgctgtttgtgatccttcgatgccaaccgaggttgtcctgcttctagacgcttggc
ctgcttggaaaaacgaaggggatgttcaagctgcagcattatccggaaatacagtacatg
tgagatctattccaccaggagctacatcatttattcaaccttgcgatctttactttttct
gtccgttgaagaatttcgtcaaaaaggtgaacgcgtacatcatctactccggtatcacct
tcaagacgtcagagcgtgacaacctgcttcgcgtgatatctgcagtgtaccgtgtctttc
gtgcaccaattttccaatca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGATCATCCGAGCTAATACGTCCCA 329 565 1004 Antisense
GACTGGGTTGAATCCGCTGTTTGTG 675 375 1054 Antisense
TTTGTGATCCTTCGATGCCAACCGA 214 665 1073 Antisense
GGAGCTACATCATTTATTCAACCTT 20 521 1201 Antisense
CTTGCGATCTTTACTTTTTCTGTCC 322 219 1223 Antisense
AGGTGAACGCGTACATCATCTACTC 15 59 1268 Antisense
TACTCCGGTATCACCTTCAAGACGT 252 647 1288 Antisense
GTCAGAGCGTGACAACCTGCTTCGC 284 467 1311 Antisense
GCTTCGCGTGATATCTGCAGTGTAC 132 307 1329 Antisense
TGCAGTGTACCGTGTCTTTCGTGCA 476 577 1344 Antisense
CTTTCGTGCACCAATTTTCCAATCA 596 223 1359 Antisense
Sequence Source Affymetrix Proprietary Database