[Home] | [Total List]

[172475_x_at]

Description B0222.7 /REP_DB=WormBase Gene ID /WP=CE06698 /TR=Q17459 /GB=AAA92324.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 23      6grp_high1_10_10 > 31      4grp_highest_8_8 > 09      4grp_high_8_8 > 61      6grp_highest_nonorm > 06      6grp_total > 32      4grp_total > 58      6grp_highest_sub > 01_02_03      6grp_cgc > 71      6grp_high1_sub > 03      6grp_cgc_sub > 03      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/172475_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20133
1 2 3 4 range
A 7743.8
(-0.7)
P
19459.8
(3)
P
19091.2
(2.9)
P
439.2
(-3)
P
19021
B 7459.6
(-0.9)
P
15754.6
(1.6)
P
20480.5
(3)
P
347.1
(-3)
P
20133
C 8295.7
(-0.1)
P
11926.5
(1.3)
P
16455.6
(3)
P
462.7
(-3)
P
15993
avr 7833
(-0.6)
15713.6
(2)
18675.8
(3)
416.3
(-3)
18260

Warning: fopen(./gnuplot/172475_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 10838
1 2 3 4 5 6 range
A 7793.4
(-0.9)
P
10970.8
(1)
P
14303.7
(3)
P
6976.7
(-1.4)
P
4309.2
(-3)
P
4339.3
(-3)
P
9995
B 9333.3
(2.7)
P
9608.2
(3)
P
9212.3
(2.5)
P
9507.6
(2.9)
P
4723.9
(-3)
P
5258.4
(-2.3)
P
4884
C 10543.3
(3)
P
9068.4
(1.7)
P
9862.4
(2.4)
P
3773
(-2.7)
P
7563.5
(0.5)
P
3465.5
(-3)
P
7078
avr 9223.3
(1.3)
9882.5
(1.9)
11126.1
(3)
6752.4
(-0.9)
5532.2
(-2)
4354.4
(-3)
6772
No Scale

Warning: fopen(./gnuplot/172475_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5671
1 2 3 4 range
A 2819.5
(0.4)
P
4224.2
(2.1)
P
4990.8
(3)
P
64.3
(-3)
P
4927
B 2378.8
(-0)
P
3891
(1.9)
P
4745.8
(3)
P
74
(-3)
P
4672
C 2746.1
(-0.2)
P
3428.9
(0.6)
P
5735.3
(3)
P
78
(-3)
P
5657
avr 2648.1
(0)
3848
(1.5)
5157.3
(3)
72.1
(-3)
5085

Warning: fopen(./gnuplot/172475_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172475_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3149
1 2 3 4 5 6 range
A 1436.7
(-2.2)
P
3901.8
(3)
P
3115
(1.3)
P
1769.4
(-1.5)
P
1300.3
(-2.5)
P
1056.5
(-3)
P
2845
B 3247.5
(3)
P
3198.2
(2.8)
P
2237
(-1.6)
P
2518.2
(-0.3)
P
1919.2
(-3)
P
1960.8
(-2.8)
P
1328
C 3907.9
(3)
P
2767.1
(0.8)
P
2510.2
(0.3)
P
758.8
(-3)
P
2447.4
(0.2)
P
1160.1
(-2.2)
P
3149
avr 2864
(1.7)
3289
(3)
2620.7
(0.9)
1682.1
(-2.1)
1889
(-1.4)
1392.5
(-3)
1897
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172475_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12479
Sequence Type Exemplar sequence
Representative Public ID B0222.7 NCBI
Target Description B0222.7 /REP_DB=WormBase Gene ID /WP=CE06698 /TR=Q17459 /GB=AAA92324.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072974(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072974 NCBI Caenorhabditis elegans COLlagen family member (col-145) (col-145) mRNA, complete cds. 11/11 None
SNAP00000023009 ENSEMBL cdna:SNAP chromosome:CEL140:V:9164636:9165574:-1 11/11 None
GENEFINDER00000023017 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:9164636:9165574:-1 11/11 None
B0222.7 ENSEMBL cdna:known chromosome:CEL140:V:9164636:9165590:-1 gene:B0222.7 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_078262 1/11 Cross Hyb Matching Probes A 
NM_078263 2/11 Cross Hyb Matching Probes A 
NM_073083 1/11 Cross Hyb Matching Probes A 
NM_073085 1/11 Cross Hyb Matching Probes A 
NM_001027492 1/11 Cross Hyb Matching Probes None
NM_069714 1/11 Cross Hyb Matching Probes A 
NM_069715 1/11 Cross Hyb Matching Probes A 
SNAP00000005950 1/11 Cross Hyb Matching Probes None
SNAP00000005951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005959 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005960 1/11 Cross Hyb Matching Probes None
SNAP00000007440 1/11 Cross Hyb Matching Probes None
SNAP00000007442 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007452 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007459 1/11 Cross Hyb Matching Probes None
SNAP00000041958 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041968 1/11 Cross Hyb Matching Probes None
F54D1.2 1/11 Cross Hyb Matching Probes R A 
F54D1.3 1/11 Cross Hyb Matching Probes R A 
T06E4.6 1/11 Cross Hyb Matching Probes A 
T06E4.4 1/11 Cross Hyb Matching Probes A 
F01G12.5b.1 1/11 Cross Hyb Matching Probes A 
F01G12.5b.2 1/11 Cross Hyb Matching Probes A 
F01G12.5a 2/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:9164636-9165575(-) 79.66 100.0
chrV:9162281-9167876(-) 76.38 90.06
Public Domain and Genome References
Gene Title
Gene Symbol col-145
Ensembl B0222.7
Entrez Gene 179297 Entrez gene
SwissProt Q17459 EMBL-EBI
WormBase CE06698 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA92324 Collagen protein 145 [Caenorhabditis elegans] ref|NP_505375.1| COLlagen family member (col-145) [Caenorhabditis elegans] 3.0E-68
blast CAE72121 Hypothetical protein CBG19217 [Caenorhabditis briggsae] 2.0E-64
blast AAA92325 Collagen protein 10 [Caenorhabditis elegans] ref|NP_505376.1| COLlagen family member (col-10) [Caenorhabditis elegans] 5.0E-62
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 1.4E-28
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.7E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 4.4E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.0E-11
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_505375.1 1 5-27
B0222.7 1 5-27
SNAP00000023009 1 5-27
GENEFINDER00000023017 1 5-27
Sequence
Target Sequence
>C. ELEGANS:172475_X_AT
tccagcctggtgccaatgtgagccaactaagccaacttgcccaccaggaccaccaggacc
accaggacagccaggagccccaggaaccccaggagccccaggaccaaagggagacgacaa
caccgctaccttcgctccactgacctgcgcccaagtctcccaagattgcgtcaagtgccc
acaaggaccagcaggaccagccggaccatcaggaccagccggaccagccggaccagacgg
acaaccaggattcccaggacaacgcggtaacgacggattcccaggagccccaggagcccc
aggagacaacggacaaccaggaacaccaggacaagacggattcccaggacagccaggagc
cgacggacaacgcggatctggagctccaggagccccaggagccccaggaaacgctggacc
agctggaccagcaggacaagatggattcccaggacaagacggagccccaggaccagccgg
accagctgggcaagacggattcccaggaaatgctggatccgatggacagccaggagcccc
aggaggaccaggacttccaggaaacgacgccgcttattgcgct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TCCAGCCTGGTGCCAATGTGAGCCA 592 589 276 Antisense
TGTGAGCCAACTAAGCCAACTTGCC 507 553 292 Antisense
CCAAGTCTCCCAAGATTGCGTCAAG 248 277 426 Antisense
TTGCGTCAAGTGCCCACAAGGACCA 114 703 441 Antisense
GACGGACAACCAGGATTCCCAGGAC 1 377 511 Antisense
CAACGCGGTAACGACGGATTCCCAG 524 185 535 Antisense
GACAAGACGGATTCCCAGGACAGCC 498 365 605 Antisense
AGGAGCCGACGGACAACGCGGATCT 42 57 630 Antisense
ATCTGGAGCTCCAGGAGCCCCAGGA 597 33 651 Antisense
CGGACCAGCTGGGCAAGACGGATTC 367 243 753 Antisense
AGGAAACGACGCCGCTTATTGCGCT 707 53 834 Antisense
Sequence Source Affymetrix Proprietary Database