[Home] | [Total List]

[172434_at]

Description F53B3.4 /REP_DB=WormBase Gene ID /WP=CE04652 /TR=Q20713 /GB=AAA81408.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 70      6grp_high1_10_10 > 07      4grp_high_8_8 > 44      6grp_highest_nonorm > 50      6grp_total > 07      4grp_total > 51      6grp_highest_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      4grp_rule_based > L2      

Scale

Warning: fopen(./gnuplot/172434_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 464
1 2 3 4 range
A 371.9
(0.8)
P
507.1
(3)
P
361.9
(0.7)
P
130.4
(-3)
P
377
B 270.6
(-0.3)
P
429.7
(3)
P
277.6
(-0.1)
P
138.2
(-3)
P
292
C 377.3
(0.2)
P
594.7
(3)
P
368.1
(0.1)
P
133
(-3)
A
462
avr 339.9
(0.3)
510.5
(3)
335.9
(0.2)
133.9
(-3)
377

Warning: fopen(./gnuplot/172434_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 825
1 2 3 4 5 6 range
A 703.5
(3)
P
450.9
(-0.6)
P
460
(-0.5)
P
407
(-1.3)
P
286.6
(-3)
P
351.2
(-2.1)
P
417
B 948.3
(3)
P
464.6
(-1.3)
P
269.4
(-3)
P
418.6
(-1.7)
P
278.5
(-2.9)
P
311.2
(-2.6)
P
679
C 1094.5
(3)
P
387.2
(-2.2)
P
359.4
(-2.4)
P
367.9
(-2.3)
P
279
(-3)
P
303.3
(-2.8)
P
816
avr 915.4
(3)
434.2
(-1.6)
362.9
(-2.2)
397.8
(-1.9)
281.4
(-3)
321.9
(-2.6)
634
No Scale

Warning: fopen(./gnuplot/172434_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 152
1 2 3 4 range
A 135.4
(3)
P
110.1
(1.7)
P
94.6
(0.9)
P
19.1
(-3)
P
116
B 86.3
(1.5)
P
106.1
(3)
P
64.3
(-0.3)
P
29.4
(-3)
P
77
C 124.9
(1.1)
P
171
(3)
P
128.3
(1.3)
P
22.4
(-3)
A
149
avr 115.5
(2.2)
129.1
(3)
95.7
(1.1)
23.6
(-3)
106

Warning: fopen(./gnuplot/172434_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172434_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 340
1 2 3 4 5 6 range
A 129.7
(0.5)
P
160.4
(3)
P
100.2
(-1.8)
P
103.2
(-1.6)
P
86.5
(-2.9)
P
85.5
(-3)
P
75
B 330
(3)
P
154.6
(-1)
P
65.4
(-3)
P
110.9
(-2)
P
113.1
(-1.9)
P
116
(-1.9)
P
265
C 405.7
(3)
P
118.1
(-2.2)
P
91.5
(-2.7)
P
74
(-3)
P
90.3
(-2.7)
P
101.5
(-2.5)
P
332
avr 288.5
(3)
144.4
(-1.3)
85.7
(-3)
96
(-2.7)
96.6
(-2.7)
101
(-2.5)
203
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 172434_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.18228
Sequence Type Exemplar sequence
Representative Public ID F53B3.4 NCBI
Target Description F53B3.4 /REP_DB=WormBase Gene ID /WP=CE04652 /TR=Q20713 /GB=AAA81408.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076098(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_076098 NCBI Caenorhabditis elegans F53B3.5 (F53B3.5) mRNA, complete cds. 11/11 A 
GENEFINDER00000011078 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:2866065:2873504:-1 11/11 None
SNAP00000011073 ENSEMBL cdna:SNAP chromosome:CEL140:X:2873370:2877504:-1 11/11 None
F53B3.5 ENSEMBL cdna:known chromosome:CEL140:X:2872801:2879612:-1 gene:F53B3.5 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:2873369-2873504(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F53B3.5
Entrez Gene 180578 Entrez gene
SwissProt Q20713 EMBL-EBI
WormBase CE30142 Wormbase
Functional Annotations
Ortholog
ID Title Organism
DROSOPHILA_2:1634191_AT dm
DROSGENOME1:154753_AT dm
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5923 tight junction inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAE58821 Hypothetical protein CBG02031 [Caenorhabditis briggsae] 0.0
blast AAA81408 Hypothetical protein F53B3.5 [Caenorhabditis elegans] ref|NP_508499.2| F53B3.5 [Caenorhabditis elegans] 1.0E-179
blast AAA81407 Hypothetical protein F53B3.3 [Caenorhabditis elegans] ref|NP_508497.2| F53B3.3 [Caenorhabditis elegans] 1.0E-155
blast CAE58820 Hypothetical protein CBG02030 [Caenorhabditis briggsae] 1.0E-137
blast AAA81408 Hypothetical protein F53B3.5 [Caenorhabditis elegans] ref|NP_508499.2| F53B3.5 [Caenorhabditis elegans] 1.0E-101
blast CAE58820 Hypothetical protein CBG02030 [Caenorhabditis briggsae] 1.0E-88
blast T16454 hypothetical protein F53B3.5 - Caenorhabditis elegans 2.0E-81
Protein Domains
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_508499.2 5 20-42,142-164,174-196,228-250,297-319
F53B3.5 5 20-42,142-164,174-196,228-250,297-319
SNAP00000011073 3 36-58,86-108,139-161
Sequence
Target Sequence
>C. ELEGANS:172434_AT
atgccaaactactatgacaagggggctggaactattgtgccatacaactacaacacgtac
gctggatatggtggctacccatattacaatcaataca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGCCAAACTACTATGACAAGGGGG 658 39 13 Antisense
ACTACTATGACAAGGGGGCTGGAAC 706 99 20 Antisense
GGGGGCTGGAACTATTGTGCCATAC 23 499 33 Antisense
GGCTGGAACTATTGTGCCATACAAC 579 539 36 Antisense
GGAACTATTGTGCCATACAACTACA 601 529 40 Antisense
GTGCCATACAACTACAACACGTACG 196 477 49 Antisense
TACAACTACAACACGTACGCTGGAT 546 627 55 Antisense
CTACAACACGTACGCTGGATATGGT 573 225 60 Antisense
GTACGCTGGATATGGTGGCTACCCA 400 457 69 Antisense
GGTGGCTACCCATATTACAATCAAT 415 499 82 Antisense
GGCTACCCATATTACAATCAATACA 91 539 85 Antisense
Sequence Source Affymetrix Proprietary Database