[Home] | [Total List]

[172380_x_at]

Description F47B3.2 /REP_DB=WormBase Gene ID /WP=CE10618 /TR=Q9TY27 /GB=AAB52357.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 88      4grp_total > 01      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/172380_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 85
1 2 3 4 range
A 5
(-3)
A
6.6
(-2.2)
A
16.9
(3)
A
13.2
(1.1)
A
12
B 5
(-3)
A
10.5
(0.4)
A
8.2
(-1)
A
14.6
(3)
A
10
C 9.5
(-2.7)
A
6.4
(-2.9)
A
4.9
(-3)
A
90.1
(3)
A
85
avr 6.5
(-3)
7.8
(-2.8)
10
(-2.4)
39.3
(3)
33

Warning: fopen(./gnuplot/172380_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 407
1 2 3 4 5 6 range
A 8
(-3)
A
4.9
(-3)
A
8.1
(-3)
A
6.3
(-3)
A
143.2
(-1)
A
410.7
(3)
P
406
B 4.3
(-3)
A
3.4
(-3)
A
7.8
(-2.9)
A
10.7
(-2.9)
A
142.9
(-0.4)
P
329.1
(3)
P
326
C 7.5
(-2.9)
A
10
(-2.9)
A
9.5
(-2.9)
A
4.3
(-3)
A
167.9
(-0.1)
P
340.9
(3)
P
337
avr 6.6
(-3)
6.1
(-3)
8.5
(-3)
7.1
(-3)
151.3
(-0.5)
360.2
(3)
354
No Scale

Warning: fopen(./gnuplot/172380_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 14
1 2 3 4 range
A 1.8
(-2.2)
A
1.4
(-3)
A
4.4
(3)
A
1.9
(-2)
A
3
B 1.6
(-3)
A
2.6
(1)
A
1.9
(-1.8)
A
3.1
(3)
A
2
C 3.1
(-2.4)
A
1.8
(-3)
A
1.7
(-3)
A
15.2
(3)
A
14
avr 2.2
(-2.6)
1.9
(-3)
2.7
(-2)
6.7
(3)
5

Warning: fopen(./gnuplot/172380_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172380_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 122
1 2 3 4 5 6 range
A 1.5
(-3)
A
1.7
(-3)
A
1.8
(-3)
A
1.6
(-3)
A
43.2
(-0.5)
A
100
(3)
P
99
B 1.5
(-3)
A
1.1
(-3)
A
1.9
(-3)
A
2.8
(-2.9)
A
58.1
(-0.2)
P
122.7
(3)
P
122
C 2.8
(-2.9)
A
3
(-2.9)
A
2.4
(-2.9)
A
0.9
(-3)
A
54.3
(-0.2)
P
114.1
(3)
P
113
avr 1.9
(-3)
1.9
(-3)
2
(-3)
1.8
(-3)
51.9
(-0.3)
112.3
(3)
111
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172380_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.265
Sequence Type Exemplar sequence
Representative Public ID F47B3.2 NCBI
Target Description F47B3.2 /REP_DB=WormBase Gene ID /WP=CE10618 /TR=Q9TY27 /GB=AAB52357.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_058875(11), NM_058876(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_058875 NCBI Caenorhabditis elegans F47B3.7 (F47B3.7) mRNA, complete cds. 11/11 A 
NM_058876 NCBI Caenorhabditis elegans F47B3.2 (F47B3.2) mRNA, complete cds. 11/11 A 
GENEFINDER00000030473 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:3963117:3969943:-1 11/11 None
SNAP00000030468 ENSEMBL cdna:SNAP chromosome:CEL140:I:3968166:3969943:-1 11/11 None
SNAP00000030469 ENSEMBL cdna:SNAP chromosome:CEL140:I:3969797:3971279:1 11/11 None
F47B3.7 ENSEMBL cdna:known chromosome:CEL140:I:3968166:3970012:-1 gene:F47B3.7 11/11 A 
F47B3.2 ENSEMBL cdna:known chromosome:CEL140:I:3970376:3971304:1 gene:F47B3.2 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:3970375-3971279(+) 100.0 100.0
chrI:3968165-3969069(-) 100.0 100.0
Public Domain and Genome References
Gene Title

Ensembl F47B3.7
F47B3.2
Entrez Gene 171983 Entrez gene
185885 Entrez gene
SwissProt Q9TY27 EMBL-EBI
O01556 EMBL-EBI
WormBase CE10618 Wormbase
CE10628 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6470 protein amino acid dephosphorylation inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4721 phosphoprotein phosphatase activity inferred from electronic annotation QuickGO AmiGO
4725 protein tyrosine phosphatase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB52362 Hypothetical protein F47B3.7 [Caenorhabditis elegans] ref|NP_491276.1| F47B3.7 [Caenorhabditis elegans] 0.0
blast AAB52356 Hypothetical protein F47B3.1 [Caenorhabditis elegans] ref|NP_491278.1| F47B3.1 [Caenorhabditis elegans] 0.0
blast AAB52361 Hypothetical protein F47B3.6 [Caenorhabditis elegans] ref|NP_491275.2| F47B3.6 [Caenorhabditis elegans] 1.0E-175
blast AAB52362 Hypothetical protein F47B3.7 [Caenorhabditis elegans] ref|NP_491276.1| F47B3.7 [Caenorhabditis elegans] 1.0E-107
blast AAB52356 Hypothetical protein F47B3.1 [Caenorhabditis elegans] ref|NP_491278.1| F47B3.1 [Caenorhabditis elegans] 3.0E-92
Protein Domains
Database ID Description E-Value
Pfam IPR000242 EMBL-EBI Tyrosine specific protein phosphatase 1.3E-102
Pfam IPR000242 EMBL-EBI Tyrosine specific protein phosphatase 6.2E-92
Pfam IPR004296 EMBL-EBI Protein of unknown function DUF236 3.6E-14
Pfam IPR000242 EMBL-EBI Tyrosine specific protein phosphatase 2.8E-48
Pfam IPR000242 EMBL-EBI Tyrosine specific protein phosphatase 3.5E-31
Sequence
Target Sequence
>C. ELEGANS:172380_X_AT
cgatacgaatccggtcgtcgttcactgctctgctggagttggtcgttctggaactattgt
gggaatttctttgattatggataagatgattcagggaattaattgcaaagacatgaaaaa
gttagtcgaggaaatccgcaatcagcgtcactatgccattcagacggaggcgcaatacat
gtacattcaccgtgttctcctcgaatacttcttggaattgcacaaagagacgtacgaagg
attgttgctgacaaagaattacgaggaaaagtatgcaaagtggctggacgattataacac
ctacgcagaagccaacgatcg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CGATACGAATCCGGTCGTCGTTCAC 145 239 48 Antisense
TTCACTGCTCTGCTGGAGTTGGTCG 684 681 68 Antisense
TCTGCTGGAGTTGGTCGTTCTGGAA 460 609 76 Antisense
GAGGAAATCCGCAATCAGCGTCACT 370 405 175 Antisense
ATCAGCGTCACTATGCCATTCAGAC 637 27 188 Antisense
GCCATTCAGACGGAGGCGCAATACA 664 277 202 Antisense
ACATGTACATTCACCGTGTTCTCCT 526 105 224 Antisense
GTGTTCTCCTCGAATACTTCTTGGA 622 485 239 Antisense
GACGTACGAAGGATTGTTGCTGACA 9 379 276 Antisense
GGCTGGACGATTATAACACCTACGC 24 535 329 Antisense
ACACCTACGCAGAAGCCAACGATCG 4 111 344 Antisense
Sequence Source Affymetrix Proprietary Database