[Home] | [Total List]

[172355_x_at]

Description T20D4.8 /REP_DB=WormBase Gene ID /WP=CE13794 /TR=P91467 /GB=AAB37589.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 73      4grp_total > 03      6grp_total_sub > Hat      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172355_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 221
1 2 3 4 range
A 14.7
(-3)
A
16.3
(-2.9)
A
24.6
(-2.6)
A
178
(3)
A
163
B 48.5
(-0.3)
A
7.4
(-3)
A
14.9
(-2.5)
A
99.9
(3)
A
93
C 28.7
(-2.4)
A
7.9
(-3)
A
8.7
(-3)
A
228.8
(3)
P
221
avr 30.6
(-2.2)
10.5
(-3)
16.1
(-2.8)
168.9
(3)
158

Warning: fopen(./gnuplot/172355_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 104
1 2 3 4 5 6 range
A 9.3
(-3)
A
32.3
(-1.6)
A
109.3
(3)
A
82.4
(1.4)
A
26.3
(-2)
A
23.3
(-2.2)
A
100
B 20.9
(-3)
A
36.3
(-2)
A
33.2
(-2.2)
A
76.4
(0.6)
A
113
(3)
A
47.4
(-1.3)
A
92
C 29.6
(-1.8)
A
81.1
(3)
A
48.6
(0)
A
16.1
(-3)
A
35.2
(-1.2)
A
65.4
(1.6)
A
65
avr 19.9
(-3)
49.9
(1.1)
63.7
(3)
58.3
(2.3)
58.2
(2.2)
45.4
(0.5)
44
No Scale

Warning: fopen(./gnuplot/172355_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 37
1 2 3 4 range
A 5.3
(-2.5)
A
3.5
(-3)
A
6.4
(-2.2)
A
26.1
(3)
A
23
B 15.5
(1.2)
A
1.8
(-3)
A
3.4
(-2.5)
A
21.3
(3)
A
20
C 9.5
(-1.8)
A
2.3
(-3)
A
3
(-2.9)
A
38.6
(3)
P
36
avr 10.1
(-1.3)
2.5
(-3)
4.3
(-2.6)
28.7
(3)
26

Warning: fopen(./gnuplot/172355_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172355_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 44
1 2 3 4 5 6 range
A 1.7
(-3)
A
11.5
(-0.3)
A
23.8
(3)
A
20.9
(2.2)
A
7.9
(-1.3)
A
5.7
(-1.9)
A
22
B 7.3
(-3)
A
12.1
(-2.3)
A
8.1
(-2.9)
A
20.2
(-1)
A
45.9
(3)
A
17.7
(-1.4)
A
39
C 11
(-0.8)
A
24.7
(3)
A
12.4
(-0.4)
A
3.2
(-3)
A
11.4
(-0.7)
A
21.9
(2.2)
A
22
avr 6.7
(-3)
16.1
(0.8)
14.8
(0.2)
14.8
(0.2)
21.7
(3)
15.1
(0.4)
15
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172355_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15152
Sequence Type Exemplar sequence
Representative Public ID T20D4.8 NCBI
Target Description T20D4.8 /REP_DB=WormBase Gene ID /WP=CE13794 /TR=P91467 /GB=AAB37589.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071552(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_071552 NCBI Caenorhabditis elegans T20D4.8 (T20D4.8) mRNA, complete cds. 11/11 None
SNAP00000008848 ENSEMBL cdna:SNAP chromosome:CEL140:V:3405535:3407719:1 11/11 None
GENEFINDER00000008867 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:3405290:3409251:1 11/11 None
T20D4.8 ENSEMBL cdna:known chromosome:CEL140:V:3405535:3407719:1 gene:T20D4.8 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_071235 1/11 Cross Hyb Matching Probes A 
NM_071551 1/11 Cross Hyb Matching Probes A 
SNAP00000008847 2/11 Cross Hyb Matching Probes None
GENEFINDER00000008863 2/11 Cross Hyb Matching Probes None
SNAP00000023997 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023999 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024001 1/11 Cross Hyb Matching Probes None
Y19D10B.6 1/11 Cross Hyb Matching Probes A 
T20D4.9 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:3405534-3407719(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl T20D4.8
Entrez Gene 188644 Entrez gene
SwissProt P91467 EMBL-EBI
WormBase CE13794 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6508 proteolysis inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4245 neprilysin activity inferred from electronic annotation QuickGO AmiGO
8237 metallopeptidase activity inferred from electronic annotation QuickGO AmiGO
8270 zinc ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB37589 Hypothetical protein T20D4.8 [Caenorhabditis elegans] ref|NP_503953.1| T20D4.8 [Caenorhabditis elegans] 0.0
blast AAF59425 Hypothetical protein Y19D10B.6 [Caenorhabditis elegans] ref|NP_503636.1| Y19D10B.6 [Caenorhabditis elegans] 0.0
blast NP_503898 T28A11.17 [Caenorhabditis elegans] gb|AAC48126.2| Hypothetical protein T28A11.17 [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR000718 EMBL-EBI Peptidase M13, neprilysin 5.2E-84
Pfam IPR000718 EMBL-EBI Peptidase M13, neprilysin 5.2E-84
Pfam IPR000718 EMBL-EBI Peptidase M13, neprilysin 5.2E-84
Sequence
Target Sequence
>C. ELEGANS:172355_X_AT
cactcggagtgatttacagaaacccatgttagcgatagccgacaccgtttttgtgcttgc
ccatgagctcatgcactttgtctatccaagcggaaaagagttactgactcctaatgttac
aaaatcagcaaacaagtgtgcacaagatgaagcgaagaggatgggtgactctgatgccgt
gaagccaatagatggatggttcagtgaaaaagtcacccatgaagatctcgcaaacttatt
gggaatgagaatggttatgaagatggtggcgaagaaatcggcaagtgaagagcagttgag
gaatgcgcttgaaacaattttgagcggattatgcatccaaggcaaaccaaaaaactcaat
tctaccacgtcatcatccctttgaaatatccatcaacaccgccgttcgtcagtatccatt
gttcagctcactctatggatgtcgctctggtgatcgaatgt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CACTCGGAGTGATTTACAGAAACCC 347 197 786 Antisense
ACAGAAACCCATGTTAGCGATAGCC 25 109 801 Antisense
GATAGCCGACACCGTTTTTGTGCTT 204 425 819 Antisense
TTTTTGTGCTTGCCCATGAGCTCAT 706 673 833 Antisense
GCTCATGCACTTTGTCTATCCAAGC 430 301 852 Antisense
AGGATGGGTGACTCTGATGCCGTGA 496 55 943 Antisense
GTCACCCATGAAGATCTCGCAAACT 295 465 997 Antisense
AAAACTCAATTCTACCACGTCATCA 428 131 1136 Antisense
TCGTCAGTATCCATTGTTCAGCTCA 458 603 1191 Antisense
GTTCAGCTCACTCTATGGATGTCGC 313 445 1206 Antisense
GGATGTCGCTCTGGTGATCGAATGT 238 515 1222 Antisense
Sequence Source Affymetrix Proprietary Database