[Home] | [Total List]

[172312_x_at]

Description K09C6.7 /REP_DB=WormBase Gene ID /WP=CE19993 /TR=O16939 /GB=AAB70675.2 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 97      4grp_total > 26      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/172312_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 93
1 2 3 4 range
A 9.7
(-3)
A
33.4
(0.4)
A
13.4
(-2.5)
A
51.7
(3)
A
42
B 9.6
(-3)
A
10
(-2.9)
A
9.5
(-3)
A
44
(3)
A
35
C 9
(-2.8)
A
77.6
(1.6)
A
5.5
(-3)
A
98.7
(3)
A
93
avr 9.4
(-3)
40.3
(0.3)
9.5
(-3)
64.8
(3)
55

Warning: fopen(./gnuplot/172312_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 136
1 2 3 4 5 6 range
A 7.9
(-2.8)
A
32.4
(-1.2)
A
5.4
(-3)
A
84.1
(2.1)
A
63.3
(0.8)
A
97.9
(3)
A
93
B 23.7
(-2)
A
11.4
(-2.9)
A
9.9
(-3)
A
13.4
(-2.7)
A
74.8
(1.8)
A
91.5
(3)
A
82
C 7.4
(-3)
A
10.2
(-2.9)
A
32.8
(-1.9)
A
29.6
(-2)
A
64.4
(-0.5)
A
141.6
(3)
A
134
avr 13
(-3)
18
(-2.7)
16
(-2.8)
42.4
(-1.2)
67.5
(0.4)
110.3
(3)
97
No Scale

Warning: fopen(./gnuplot/172312_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20
1 2 3 4 range
A 3.5
(-3)
A
7.3
(2.6)
A
3.5
(-3)
A
7.6
(3)
A
4
B 3
(-2.3)
A
2.5
(-2.8)
A
2.2
(-3)
A
9.4
(3)
A
7
C 3
(-2.7)
A
22.3
(3)
A
1.9
(-3)
A
16.6
(1.3)
A
20
avr 3.2
(-2.5)
10.7
(2.7)
2.5
(-3)
11.2
(3)
9

Warning: fopen(./gnuplot/172312_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172312_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 46
1 2 3 4 5 6 range
A 1.5
(-2.9)
A
11.5
(-0.3)
A
1.2
(-3)
A
21.3
(2.3)
A
19.1
(1.8)
A
23.8
(3)
A
23
B 8.3
(-1.9)
A
3.8
(-2.7)
A
2.4
(-3)
A
3.5
(-2.8)
A
30.4
(2.3)
A
34.1
(3)
A
32
C 2.7
(-3)
A
3.1
(-2.9)
A
8.3
(-2.2)
A
6
(-2.6)
A
20.8
(-0.6)
A
47.4
(3)
A
45
avr 4.2
(-3)
6.1
(-2.6)
4
(-3)
10.3
(-1.8)
23.4
(0.7)
35.1
(3)
31
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172312_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.15491
Sequence Type Exemplar sequence
Representative Public ID K09C6.7 NCBI
Target Description K09C6.7 /REP_DB=WormBase Gene ID /WP=CE19993 /TR=O16939 /GB=AAB70675.2 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070936(11), NM_070937(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070936 NCBI Caenorhabditis elegans K09C6.7 (K09C6.7) mRNA, complete cds. 11/11 A 
NM_070937 NCBI Caenorhabditis elegans K09C6.8 (K09C6.8) mRNA, complete cds. 10/11 A 
SNAP00000012264 ENSEMBL cdna:SNAP chromosome:CEL140:V:835633:838903:-1 11/11 None
SNAP00000012266 ENSEMBL cdna:SNAP chromosome:CEL140:V:840086:842432:-1 10/11 None
GENEFINDER00000012284 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:840086:842432:-1 10/11 None
GENEFINDER00000012285 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:835670:838157:-1 11/11 None
K09C6.7 ENSEMBL cdna:known chromosome:CEL140:V:835633:838903:-1 gene:K09C6.7 11/11 A 
K09C6.8 ENSEMBL cdna:known chromosome:CEL140:V:840086:843027:-1 gene:K09C6.8 10/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_182437 1/11 Cross Hyb Matching Probes A 
SNAP00000014347 2/11 Cross Hyb Matching Probes None
GENEFINDER00000014362 1/11 Cross Hyb Matching Probes None
T10B5.2 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:835632-838903(-) 100.0 100.0
Public Domain and Genome References
Gene Title

Ensembl K09C6.7
K09C6.8
Entrez Gene 178589 Entrez gene
178590 Entrez gene
SwissProt O16939 EMBL-EBI
O16940 EMBL-EBI
WormBase CE35338 Wormbase
CE12002 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6468 protein amino acid phosphorylation inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4672 protein kinase activity inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB70675 Hypothetical protein K09C6.7 [Caenorhabditis elegans] ref|NP_503337.2| K09C6.7 [Caenorhabditis elegans] 0.0
blast AAB70674 Hypothetical protein K09C6.8 [Caenorhabditis elegans] ref|NP_503338.1| K09C6.8 [Caenorhabditis elegans] 0.0
blast AAO25993 Hypothetical protein T10B5.2 [Caenorhabditis elegans] ref|NP_872237.2| T10B5.2 [Caenorhabditis elegans] 1.0E-170
Sequence
Target Sequence
>C. ELEGANS:172312_X_AT
ctcgttctctcttctcagaaacaacaaagcagtcgtcgtgctcaatagtttcttcaactc
cgaaacgcgtcaaaacatcagtcgtaacattcgtacaacgaagcacaatgggctgcagcc
tctttacgttcaacaggcccgacatgcccgtaacaaatcggagcgagagccactgccgaa
gaacgtcatcaacacttacatgtcgaggcgtcaacatttccgattggcacgaggacctgc
cgacgactacgagtcgtggttttacatttgtgcacggtttatcactctgaaaacctttga
gtggcacgacgaggaggatcacatcgtggcggcaacaatgaagtacaactatctggccac
gtgcacgtttccagacccagatactaatgagaggatggcaaagattctacagtactgtct
gtctgcgacgaatacgaacgccaatgtagtcgcgttttatctcgaacgcgtcattcagaa
ctggaaagaaaacattccgccaaaggagttctattcgtggcaggacac


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CTCGTTCTCTCTTCTCAGAAACAAC 410 233 1173 Antisense
GTCGTCGTGCTCAATAGTTTCTTCA 482 473 1204 Antisense
GCACAATGGGCTGCAGCCTCTTTAC 238 317 1275 Antisense
GCCTCTTTACGTTCAACAGGCCCGA 53 281 1290 Antisense
GCCACTGCCGAAGAACGTCATCAAC 354 279 1341 Antisense
AGGCGTCAACATTTCCGATTGGCAC 148 53 1378 Antisense
TGAAGTACAACTATCTGGCCACGTG 474 573 1511 Antisense
CACGTTTCCAGACCCAGATACTAAT 439 197 1536 Antisense
GTACTGTCTGTCTGCGACGAATACG 673 455 1584 Antisense
GTTTTATCTCGAACGCGTCATTCAG 369 449 1626 Antisense
AGGAGTTCTATTCGTGGCAGGACAC 629 55 1676 Antisense
Sequence Source Affymetrix Proprietary Database