[Home] | [Total List]

[172306_x_at]

Description Y26D4A.9 /REP_DB=WormBase Gene ID /WP=CE21489 /TR=Q9U2P7 /GB=CAB54347.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 83      4grp_total > 09      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/172306_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 38
1 2 3 4 range
A 9.5
(-2.2)
A
4.2
(-3)
A
24.6
(0.2)
A
42.2
(3)
A
38
B 5.8
(-2.5)
A
25.8
(2.2)
A
3.8
(-3)
A
29.4
(3)
A
26
C 8.7
(-2.7)
A
9.2
(-2.5)
A
7.9
(-3)
A
22.5
(3)
A
15
avr 8
(-3)
13.1
(-1.7)
12.1
(-1.9)
31.4
(3)
23

Warning: fopen(./gnuplot/172306_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 17
1 2 3 4 5 6 range
A 2.2
(-2.2)
A
3
(-1.7)
A
7.4
(1.4)
A
3.5
(-1.3)
A
9.6
(3)
A
1.1
(-3)
A
9
B 9.1
(-0)
A
0.8
(-3)
A
17.5
(3)
A
10.2
(0.4)
A
9.8
(0.2)
A
1.1
(-2.9)
A
17
C 1.8
(-2.3)
A
0.5
(-3)
A
8.1
(0.9)
A
1.9
(-2.3)
A
12.1
(3)
A
1.6
(-2.4)
A
12
avr 4.4
(-1.1)
1.4
(-2.9)
11
(3)
5.2
(-0.6)
10.5
(2.7)
1.3
(-3)
10
No Scale

Warning: fopen(./gnuplot/172306_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6
1 2 3 4 range
A 3.5
(-0.2)
A
0.9
(-3)
A
6.4
(3)
A
6.2
(2.8)
A
6
B 1.9
(-1.9)
A
6.4
(3)
A
0.9
(-3)
A
6.3
(2.9)
A
6
C 2.9
(-1.9)
A
2.7
(-3)
A
2.8
(-2.5)
A
3.8
(3)
A
1
avr 2.8
(-3)
3.3
(-1.8)
3.4
(-1.6)
5.4
(3)
3

Warning: fopen(./gnuplot/172306_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172306_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4
1 2 3 4 5 6 range
A 0.4
(-2.8)
A
1.1
(-1.2)
A
1.6
(0)
A
0.9
(-1.6)
A
2.9
(3)
A
0.3
(-3)
A
3
B 3.2
(1.5)
A
0.3
(-3)
A
4.2
(3)
A
2.7
(0.7)
A
4
(2.7)
A
0.4
(-2.8)
A
4
C 0.7
(-2.2)
A
0.2
(-3)
A
2.1
(0.1)
A
0.4
(-2.7)
A
3.9
(3)
A
0.5
(-2.5)
A
4
avr 1.4
(-1.1)
0.5
(-2.8)
2.6
(1.1)
1.3
(-1.3)
3.6
(3)
0.4
(-3)
3
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172306_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.2059
Sequence Type Exemplar sequence
Representative Public ID Y26D4A.9 NCBI
Target Description Y26D4A.9 /REP_DB=WormBase Gene ID /WP=CE21489 /TR=Q9U2P7 /GB=CAB54347.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060890(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060890 NCBI Caenorhabditis elegans Y26D4A.9 (Y26D4A.9) mRNA, complete cds. 11/11 None
SNAP00000013485 ENSEMBL cdna:SNAP chromosome:CEL140:I:13094803:13095351:-1 10/11 None
Y26D4A.9 ENSEMBL cdna:known chromosome:CEL140:I:13094803:13097688:-1 gene:Y26D4A.9 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_060303 2/11 Cross Hyb Matching Probes A 
GENEFINDER00000021086 2/11 Cross Hyb Matching Probes None
SNAP00000021075 2/11 Cross Hyb Matching Probes None
GENEFINDER00000013612 8/11 Cross Hyb Matching Probes None
Y106G6G.5 2/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:10323237-10326072(+) 85.52 93.7
chrI:13094733-13097619(-) 91.77 100.0
Public Domain and Genome References
Gene Title
Ensembl Y26D4A.9
Entrez Gene 189549 Entrez gene
SwissProt Q9U2P7 EMBL-EBI
WormBase CE21489 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
4867 serine-type endopeptidase inhibitor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB54347 Hypothetical protein Y26D4A.9 [Caenorhabditis elegans] ref|NP_493291.1| Y26D4A.9 [Caenorhabditis elegans] 0.0
blast CAA22056 Hypothetical protein Y106G6G.5 [Caenorhabditis elegans] ref|NP_492704.1| Y106G6G.5 [Caenorhabditis elegans] 0.0
blast CAE61411 Hypothetical protein CBG05275 [Caenorhabditis briggsae] 0.0
blast CAB54347 Hypothetical protein Y26D4A.9 [Caenorhabditis elegans] ref|NP_493291.1| Y26D4A.9 [Caenorhabditis elegans] 6.0E-95
blast CAA22056 Hypothetical protein Y106G6G.5 [Caenorhabditis elegans] ref|NP_492704.1| Y106G6G.5 [Caenorhabditis elegans] 5.0E-88
blast CAE69637 Hypothetical protein CBG15878 [Caenorhabditis briggsae] 1.0E-62
Sequence
Target Sequence
>C. ELEGANS:172306_X_AT
caagccgttttatgtagggatgagtattttagatttgagtaagaatctaatgtatgattt
tcattataatgtaatggagcctaagtatggagatggtttgaagttgtgttaccaagacac
cgattctttcatctatgaaataaaaactgaggatgtttatgatgatatgaaaaatatgaa
agaatggttcgatttttctgactatccaaaagaccatccactttatgatgatgagaataa
aaaggtaattgggaagtttaaggatgagcttaatggaaatattatgagtgagattgtggc
atttaggcctaaacagtatgcttttagattttctaaattaaatgatcgtttggaggtgga
ggttaagaaaaataaaggagtaaaaaggagtgttgtaaagaaggaattaacttttgctga
ttataagaactgtttatttgataaaacggtttcaaggaagcagcaaatgttgataagctc
aagcaaacatcaagttcattctgttcaacag


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CAAGCCGTTTTATGTAGGGATGAGT 491 185 1614 Antisense
GGTTTGAAGTTGTGTTACCAAGACA 422 191 1708 Antisense
GTTACCAAGACACCGATTCTTTCAT 663 445 1721 Antisense
AGACACCGATTCTTTCATCTATGAA 705 71 1728 Antisense
AATGGTTCGATTTTTCTGACTATCC 207 163 1796 Antisense
CTGACTATCCAAAAGACCATCCACT 686 237 1811 Antisense
AAGACCATCCACTTTATGATGATGA 30 155 1823 Antisense
TGAGTGAGATTGTGGCATTTAGGCC 286 553 1898 Antisense
ATTTAGGCCTAAACAGTATGCTTTT 298 15 1914 Antisense
AACAGTATGCTTTTAGATTTTCTAA 524 137 1925 Antisense
ACATCAAGTTCATTCTGTTCAACAG 660 105 2100 Antisense
Sequence Source Affymetrix Proprietary Database