[Home] | [Total List]

[172281_at]

Description F31A9.2 /REP_DB=WormBase Gene ID /WP=CE07163 /TR=Q19924 /GB=AAB00605.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Cluster 6grp_total > 99      4grp_total > 02      6grp_total_sub > Increase      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172281_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 182
1 2 3 4 range
A 0.9
(-3)
A
0.9
(-3)
A
1.5
(-3)
A
139.7
(3)
A
139
B 2.4
(-2.9)
A
0.7
(-3)
A
0.9
(-3)
A
119.5
(3)
P
119
C 6.1
(-2.8)
A
1
(-3)
A
0.9
(-3)
A
182.4
(3)
P
182
avr 3.1
(-2.9)
0.9
(-3)
1.1
(-3)
147.2
(3)
146

Warning: fopen(./gnuplot/172281_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 37
1 2 3 4 5 6 range
A 1.5
(-2.5)
A
0.4
(-3)
A
3.2
(-1.8)
A
2.5
(-2.1)
A
14
(3)
A
1.8
(-2.4)
A
14
B 1.1
(-3)
A
1.4
(-2.9)
A
4.6
(-2.1)
A
13.8
(0.1)
A
24.2
(2.7)
A
25.4
(3)
A
24
C 15.5
(-0.6)
A
1
(-3)
A
1.7
(-2.9)
A
1.3
(-3)
A
37.2
(3)
M
23.3
(0.7)
A
36
avr 6
(-1.7)
0.9
(-3)
3.2
(-2.4)
5.9
(-1.8)
25.1
(3)
16.8
(0.9)
24
No Scale

Warning: fopen(./gnuplot/172281_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 31
1 2 3 4 range
A 0.3
(-3)
A
0.2
(-3)
A
0.4
(-2.9)
A
20.4
(3)
A
20
B 0.8
(-2.9)
A
0.2
(-3)
A
0.2
(-3)
A
25.5
(3)
P
25
C 2
(-2.7)
A
0.3
(-3)
A
0.3
(-3)
A
30.8
(3)
P
31
avr 1
(-2.8)
0.2
(-3)
0.3
(-3)
25.6
(3)
25

Warning: fopen(./gnuplot/172281_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172281_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12
1 2 3 4 5 6 range
A 0.3
(-2.9)
A
0.2
(-3)
A
0.7
(-2.3)
A
0.6
(-2.4)
A
4.2
(3)
A
0.4
(-2.7)
A
4
B 0.4
(-3)
A
0.5
(-2.9)
A
1.1
(-2.6)
A
3.7
(-0.9)
A
9.8
(3)
A
9.5
(2.8)
A
9
C 5.8
(-0.2)
A
0.3
(-3)
A
0.4
(-2.9)
A
0.3
(-3)
A
12
(3)
M
7.8
(0.8)
A
12
avr 2.2
(-1.6)
0.3
(-3)
0.7
(-2.7)
1.5
(-2.1)
8.7
(3)
5.9
(1)
8
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 172281_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.18450
Sequence Type Exemplar sequence
Representative Public ID F31A9.2 NCBI
Target Description F31A9.2 /REP_DB=WormBase Gene ID /WP=CE07163 /TR=Q19924 /GB=AAB00605.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_075928(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_075928 NCBI Caenorhabditis elegans F31A9.2 (F31A9.2) mRNA, complete cds. 11/11 None
F31A9.2 ENSEMBL cdna:known chromosome:CEL140:X:1794811:1795668:1 gene:F31A9.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:1795530-1795668(+) 94.79 100.0
Public Domain and Genome References
Gene Title
Ensembl F31A9.2
Entrez Gene 185138 Entrez gene
SwissProt Q19924 EMBL-EBI
WormBase CE07163 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAB00605 Hypothetical protein F31A9.2 [Caenorhabditis elegans] ref|NP_508329.1| F31A9.2 [Caenorhabditis elegans] 2.0E-10
Sequence
Target Sequence
>C. ELEGANS:172281_AT
atgcaggtgcgatcgtggtcaaacgacaagcgctatatgagtcagagaaagcttgaaaga
cactt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATGCAGGTGCGATCGTGGTCAAACG 565 41 13 Antisense
GCAGGTGCGATCGTGGTCAAACGAC 491 311 15 Antisense
AGGTGCGATCGTGGTCAAACGACAA 336 53 17 Antisense
GTGCGATCGTGGTCAAACGACAAGC 677 477 19 Antisense
GCGATCGTGGTCAAACGACAAGCGC 573 289 21 Antisense
GATCGTGGTCAAACGACAAGCGCTA 679 417 23 Antisense
CGTGGTCAAACGACAAGCGCTATAT 104 245 26 Antisense
GGTCAAACGACAAGCGCTATATGAG 621 501 29 Antisense
AACGACAAGCGCTATATGAGTCAGA 561 145 34 Antisense
ACAAGCGCTATATGAGTCAGAGAAA 581 105 38 Antisense
GTCAGAGAAAGCTTGAAAGACACTT 362 461 53 Antisense
Sequence Source Affymetrix Proprietary Database