[Home] | [Total List]

[172253_x_at]

Description F39E9.7 /REP_DB=WormBase Gene ID /WP=CE10110 /TR=O17113 /GB=AAB70372.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 76      4grp_total > 02      6grp_total_sub > Increase      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/172253_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 715
1 2 3 4 range
A 46.1
(-2.9)
A
67.5
(-2.7)
A
38.2
(-3)
A
738.8
(3)
P
701
B 100.2
(-2.3)
P
101.6
(-2.3)
A
24
(-3)
A
697.6
(3)
P
674
C 93.7
(-2.6)
P
94
(-2.6)
A
46.3
(-3)
A
716.5
(3)
P
670
avr 80
(-2.6)
87.7
(-2.5)
36.2
(-3)
717.6
(3)
681

Warning: fopen(./gnuplot/172253_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 228
1 2 3 4 5 6 range
A 42.7
(-3)
A
58.4
(-2.3)
A
104.7
(-0.2)
A
58
(-2.3)
A
54.5
(-2.5)
A
176.9
(3)
P
134
B 33.9
(-2.9)
A
30.6
(-3)
P
104.2
(-1.1)
A
45
(-2.6)
A
94
(-1.3)
P
258.6
(3)
P
228
C 66.6
(-3)
A
80
(-2.5)
A
83.2
(-2.3)
A
100.9
(-1.6)
A
81.6
(-2.4)
A
218.4
(3)
P
152
avr 47.7
(-3)
56.3
(-2.7)
97.4
(-1.2)
68
(-2.3)
76.7
(-2)
218
(3)
170
No Scale

Warning: fopen(./gnuplot/172253_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 143
1 2 3 4 range
A 16.8
(-2.6)
A
14.6
(-2.7)
A
10
(-3)
A
108.1
(3)
P
98
B 31.9
(-1.9)
P
25.1
(-2.2)
A
5.6
(-3)
A
148.7
(3)
P
143
C 31
(-2.2)
P
27
(-2.4)
A
16.2
(-3)
A
120.8
(3)
P
105
avr 26.6
(-2.2)
22.2
(-2.4)
10.6
(-3)
125.9
(3)
115

Warning: fopen(./gnuplot/172253_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172253_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 89
1 2 3 4 5 6 range
A 7.9
(-3)
A
20.8
(-0.8)
A
22.8
(-0.5)
A
14.7
(-1.8)
A
16.4
(-1.6)
A
43.1
(3)
P
35
B 11.8
(-2.9)
A
10.2
(-3)
P
25.3
(-1.9)
A
11.9
(-2.9)
A
38.2
(-1.1)
P
96.4
(3)
P
86
C 24.7
(-2.5)
A
24.4
(-2.5)
A
21.2
(-2.9)
A
20.3
(-3)
A
26.4
(-2.3)
A
73.1
(3)
P
53
avr 14.8
(-3)
18.5
(-2.6)
23.1
(-2.1)
15.6
(-2.9)
27
(-1.7)
70.9
(3)
56
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172253_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4236
Sequence Type Exemplar sequence
Representative Public ID F39E9.7 NCBI
Target Description F39E9.7 /REP_DB=WormBase Gene ID /WP=CE10110 /TR=O17113 /GB=AAB70372.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062100(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_062100 NCBI Caenorhabditis elegans F39E9.7 (F39E9.7) mRNA, complete cds. 11/11 None
GENEFINDER00000020876 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:3304194:3310360:-1 9/11 None
F39E9.7 ENSEMBL cdna:known chromosome:CEL140:II:3306027:3307113:-1 gene:F39E9.7 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_075794 3/11 Cross Hyb Matching Probes A 
SNAP00000020869 8/11 Cross Hyb Matching Probes None
SNAP00000039511 3/11 Cross Hyb Matching Probes None
GENEFINDER00000039520 3/11 Cross Hyb Matching Probes None
F55A4.4 3/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:3306025-3307112(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl F39E9.7
Entrez Gene 185495 Entrez gene
SwissProt O17113 EMBL-EBI
WormBase CE10110 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5622 intracellular inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3725 double-stranded RNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB70372 Hypothetical protein F39E9.7 [Caenorhabditis elegans] ref|NP_494501.1| F39E9.7 [Caenorhabditis elegans] 9.0E-71
blast AAB70372 Hypothetical protein F39E9.7 [Caenorhabditis elegans] ref|NP_494501.1| F39E9.7 [Caenorhabditis elegans] 4.0E-49
blast AAB07562 Hypothetical protein F55A4.4 [Caenorhabditis elegans] ref|NP_508195.1| F55A4.4 [Caenorhabditis elegans] 3.0E-46
blast AAB07566 Hypothetical protein F55A4.5 [Caenorhabditis elegans] ref|NP_508196.1| F55A4.5 [Caenorhabditis elegans] 1.0E-19
blast AAB07566 Hypothetical protein F55A4.5 [Caenorhabditis elegans] ref|NP_508196.1| F55A4.5 [Caenorhabditis elegans] 6.0E-19
Protein Domains
Database ID Description E-Value
Pfam IPR001159 EMBL-EBI Double-stranded RNA binding (DsRBD) domain 4.7E-17
Pfam IPR000718 EMBL-EBI Peptidase M13, neprilysin 4.9E-7
Pfam IPR001159 EMBL-EBI Double-stranded RNA binding (DsRBD) domain 4.7E-17
Sequence
Target Sequence
>C. ELEGANS:172253_X_AT
tgccaaaaaagtgcccttgctgccaatgtgcgcaaaaccgaaaagaagcaggccacaatg
aaaaaagatgaggagattgatgtcctgaacccagtggcccaattaaacgaatatgcacaa
aaattttataaaaagtatccgactttcgagtttgtcaaagaacaagccgtgggcaagcac
agagtatttattatccaagcaacatttgaagacaaaactctggaagggagaggtccaagt
aagatgatagcaaaaagagcagctgccgaagcaattctcgagtcgattgggttcataaaa
ccatcgctaagaaaattttcagataaattccgagaaaaaagtgagagagcatttcgacaa
ttttc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGCCAAAAAAGTGCCCTTGCTGCCA 116 585 25 Antisense
CTTGCTGCCAATGTGCGCAAAACCG 147 219 40 Antisense
TCCTGAACCCAGTGGCCCAATTAAA 654 587 107 Antisense
TGGCCCAATTAAACGAATATGCACA 505 543 119 Antisense
AAGTATCCGACTTTCGAGTTTGTCA 342 157 157 Antisense
CAAGCCGTGGGCAAGCACAGAGTAT 299 187 187 Antisense
AGAGTATTTATTATCCAAGCAACAT 310 67 205 Antisense
GAGAGGTCCAAGTAAGATGATAGCA 436 391 252 Antisense
GAGCAGCTGCCGAAGCAATTCTCGA 521 389 281 Antisense
TTCTCGAGTCGATTGGGTTCATAAA 544 691 299 Antisense
GTGAGAGAGCATTTCGACAATTTTC 311 481 365 Antisense
Sequence Source Affymetrix Proprietary Database