[Home] | [Total List]

[172223_x_at]

Description W02D9.5 /REP_DB=WormBase Gene ID /WP=CE14462 /TR=Q9XVH1 /GB=CAB03462.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_total > 99      4grp_total > 61      6grp_total_sub > Increase      4grp_rule_based > L1      

Scale

Warning: fopen(./gnuplot/172223_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 80
1 2 3 4 range
A 80.4
(2.5)
A
25.9
(-1.6)
A
87.3
(3)
A
7.3
(-3)
A
80
B 69.3
(3)
A
62.2
(2.3)
A
46.4
(0.7)
A
10.7
(-3)
A
59
C 58
(0.9)
A
82.5
(3)
A
36.5
(-0.9)
A
11.9
(-3)
A
71
avr 69.2
(3)
56.9
(1.8)
56.7
(1.7)
10
(-3)
59

Warning: fopen(./gnuplot/172223_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 266
1 2 3 4 5 6 range
A 76.5
(-1.3)
A
31
(-2.4)
A
8.9
(-3)
A
26.1
(-2.6)
A
248.2
(3)
M
222.3
(2.4)
A
239
B 66.1
(-2.1)
A
27.7
(-3)
A
36.1
(-2.8)
A
109.1
(-1)
A
275.3
(3)
P
239.5
(2.1)
P
248
C 67.8
(-1.6)
A
68.8
(-1.6)
A
10.3
(-3)
A
16.7
(-2.8)
A
253.4
(3)
P
203.8
(1.8)
A
243
avr 70.1
(-1.7)
42.5
(-2.4)
18.4
(-3)
50.6
(-2.2)
259
(3)
221.9
(2.1)
241
No Scale

Warning: fopen(./gnuplot/172223_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 28
1 2 3 4 range
A 29.3
(3)
A
5.6
(-2)
A
22.8
(1.6)
A
1.1
(-3)
A
28
B 22.1
(3)
A
15.4
(1)
A
10.8
(-0.4)
A
2.3
(-3)
A
20
C 19.2
(1.8)
A
23.7
(3)
A
12.7
(-0)
A
2
(-3)
A
22
avr 23.5
(3)
14.9
(0.6)
15.4
(0.8)
1.8
(-3)
22

Warning: fopen(./gnuplot/172223_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172223_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 110
1 2 3 4 5 6 range
A 14.1
(-2)
A
11
(-2.3)
A
1.9
(-3)
A
6.6
(-2.6)
A
74.9
(3)
M
54.1
(1.3)
A
73
B 23
(-2.2)
A
9.2
(-3)
A
8.8
(-3)
A
28.9
(-1.8)
A
111.9
(3)
P
89.3
(1.7)
P
103
C 25.1
(-1.3)
A
21
(-1.6)
A
2.6
(-3)
A
3.4
(-2.9)
A
82
(3)
P
68.2
(2)
A
79
avr 20.7
(-1.9)
13.7
(-2.3)
4.4
(-3)
13
(-2.4)
89.6
(3)
70.5
(1.7)
85
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172223_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1481
Sequence Type Exemplar sequence
Representative Public ID W02D9.5 NCBI
Target Description W02D9.5 /REP_DB=WormBase Gene ID /WP=CE14462 /TR=Q9XVH1 /GB=CAB03462.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060784(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060784 NCBI Caenorhabditis elegans W02D9.5 (W02D9.5) mRNA, complete cds. 11/11 None
GENEFINDER00000003950 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:12569261:12569797:-1 11/11 None
W02D9.5 ENSEMBL cdna:known chromosome:CEL140:I:12569207:12569669:-1 gene:W02D9.5 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_068296 1/11 Cross Hyb Matching Probes None
NM_068298 1/11 Cross Hyb Matching Probes None
NM_069366 1/11 Cross Hyb Matching Probes A 
NM_058599 1/11 Cross Hyb Matching Probes None
SNAP00000003940 7/11 Cross Hyb Matching Probes None
SNAP00000004252 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004269 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020624 1/11 Cross Hyb Matching Probes None
K07F5.9 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:12569191-12569600(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Ensembl W02D9.5
Entrez Gene 173127 Entrez gene
SwissProt Q9XVH1 EMBL-EBI
WormBase CE14462 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03462 Hypothetical protein W02D9.5 [Caenorhabditis elegans] ref|NP_493185.1| W02D9.5 [Caenorhabditis elegans] 3.0E-43
blast CAA94274 Hypothetical protein K07F5.9 [Caenorhabditis elegans] ref|NP_501767.1| Sperm-Specific family, class P family member (ssp-10) [Caenorhabditis elegans] 5.0E-15
blast AAB04599 Sperm-specific family, class p protein 11 [Caenorhabditis elegans] ref|NP_500699.1| Sperm-Specific family, class P family member (ssp-11) [Caenorhabditis elegans] ref|NP_500697.1| Sperm-Specific family, class P family member (ssp-9) [Caenorhabditis elegans] gb|AAC47985.1| Sperm-specific family, class p protein 9 [Caenorhabditis elegans] 5.0E-15
blast CAA94274 Hypothetical protein K07F5.9 [Caenorhabditis elegans] ref|NP_501767.1| Sperm-Specific family, class P family member (ssp-10) [Caenorhabditis elegans] 6.0E-15
blast AAB04599 Sperm-specific family, class p protein 11 [Caenorhabditis elegans] ref|NP_500699.1| Sperm-Specific family, class P family member (ssp-11) [Caenorhabditis elegans] ref|NP_500697.1| Sperm-Specific family, class P family member (ssp-9) [Caenorhabditis elegans] gb|AAC47985.1| Sperm-specific family, class p protein 9 [Caenorhabditis elegans] 6.0E-15
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 3.2E-12
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 3.2E-12
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000003950 1 46-63
Sequence
Target Sequence
>C. ELEGANS:172223_X_AT
tgaatcttcttcttatcttctttgctgctatggtttccggttcctttggcgcattcttcc
gcaagaccctgtccctgactgccgatccaccaacttgtaccgtcccagccactggaggat
tttcggcccacaagctcgtcaatgagttcggatttgtcgatccattcggatcaaaggata
ttgtgatcacccgcactgctggtgcaccaaattggaatgataagcttgtcattcattatg
caccagctccagctgatgctactgatgctcaagccgcttttgctgcagccactcttactg
gtcaggca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGAATCTTCTTCTTATCTTCTTTGC 121 577 14 Antisense
TCTTCTTTGCTGCTATGGTTTCCGG 469 615 29 Antisense
TACCGTCCCAGCCACTGGAGGATTT 636 647 111 Antisense
ACAAGCTCGTCAATGAGTTCGGATT 474 113 143 Antisense
GTTCGGATTTGTCGATCCATTCGGA 153 415 159 Antisense
AAGGATATTGTGATCACCCGCACTG 139 161 187 Antisense
CCGCACTGCTGGTGCACCAAATTGG 326 261 204 Antisense
TGTCATTCATTATGCACCAGCTCCA 390 559 240 Antisense
CCAGCTCCAGCTGATGCTACTGATG 353 273 256 Antisense
TACTGATGCTCAAGCCGCTTTTGCT 190 647 273 Antisense
TGCAGCCACTCTTACTGGTCAGGCA 423 577 297 Antisense
Sequence Source Affymetrix Proprietary Database