[Home] | [Total List]

[172196_x_at]

Description K08C9.4 /REP_DB=WormBase Gene ID /WP=CE18860 /TR=Q9XUT4 /GB=CAB04587.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 08      6grp_high1_10_10 > 43      6grp_highest_nonorm > 23      6grp_total > 10      4grp_total > 49      6grp_cgc > 64      6grp_high1_sub > 02      6grp_total_sub > Hat      4grp_rule_based > L3      

Scale

Warning: fopen(./gnuplot/172196_x_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4554
1 2 3 4 range
A 120.2
(-3)
A
4578.7
(2.9)
P
4625.4
(3)
P
153.5
(-3)
A
4505
B 197.6
(-2.8)
A
3798
(2)
P
4583.9
(3)
P
71.7
(-3)
A
4512
C 186.4
(-3)
A
3973.2
(3)
P
3847.4
(2.8)
P
155.2
(-3)
A
3818
avr 168.1
(-2.9)
4116.6
(2.7)
4352.2
(3)
126.8
(-3)
4225

Warning: fopen(./gnuplot/172196_x_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3372
1 2 3 4 5 6 range
A 610
(-3)
P
3981.5
(3)
P
1892.7
(-0.7)
P
2072
(-0.4)
P
2040.5
(-0.5)
P
2227.1
(-0.1)
P
3372
B 728.1
(-3)
P
3331.6
(3)
P
2467.9
(1)
P
1713.7
(-0.7)
P
2101.5
(0.2)
P
1791.2
(-0.5)
P
2604
C 815.9
(-3)
P
3079.3
(3)
P
2518.2
(1.5)
P
1622.4
(-0.9)
P
2864.4
(2.4)
P
1407.6
(-1.4)
P
2263
avr 718
(-3)
3464.1
(3)
2292.9
(0.4)
1802.7
(-0.6)
2335.5
(0.5)
1808.6
(-0.6)
2746
No Scale

Warning: fopen(./gnuplot/172196_x_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1326
1 2 3 4 range
A 43.8
(-2.9)
A
993.9
(1.9)
P
1209.2
(3)
P
22.5
(-3)
A
1187
B 63
(-2.7)
A
938
(2.3)
P
1062.2
(3)
P
15.3
(-3)
A
1047
C 61.7
(-2.8)
A
1142.3
(2.1)
P
1340.9
(3)
P
26.2
(-3)
A
1315
avr 56.2
(-2.8)
1024.7
(2.1)
1204.1
(3)
21.3
(-3)
1183

Warning: fopen(./gnuplot/172196_x_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/172196_x_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1304
1 2 3 4 5 6 range
A 112.5
(-3)
P
1416
(3)
P
412.2
(-1.6)
P
525.5
(-1.1)
P
615.7
(-0.7)
P
542.2
(-1)
P
1304
B 253.3
(-3)
P
1109
(3)
P
599.3
(-0.6)
P
453.9
(-1.6)
P
853.8
(1.2)
P
667.9
(-0.1)
P
856
C 302.4
(-3)
P
939.6
(3)
P
640.9
(0.2)
P
326.3
(-2.8)
P
926.9
(2.9)
P
471.2
(-1.4)
P
637
avr 222.7
(-3)
1154.9
(3)
550.8
(-0.9)
435.2
(-1.6)
798.8
(0.7)
560.4
(-0.8)
932
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172196_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.2452
Sequence Type Exemplar sequence
Representative Public ID K08C9.4 NCBI
Target Description K08C9.4 /REP_DB=WormBase Gene ID /WP=CE18860 /TR=Q9XUT4 /GB=CAB04587.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060535(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060535 NCBI Caenorhabditis elegans COLlagen family member (col-65) (col-65) mRNA, complete cds. 11/11 None
SNAP00000013576 ENSEMBL cdna:SNAP chromosome:CEL140:I:11497352:11498682:-1 11/11 None
GENEFINDER00000013583 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:11497352:11498682:-1 11/11 None
K08C9.4 ENSEMBL cdna:known chromosome:CEL140:I:11497352:11498682:-1 gene:K08C9.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_060547 2/11 Cross Hyb Matching Probes A 
NM_069125 1/11 Cross Hyb Matching Probes A 
NM_069126 1/11 Cross Hyb Matching Probes A 
NM_072673 1/11 Cross Hyb Matching Probes A 
SNAP00000000119 2/11 Cross Hyb Matching Probes None
GENEFINDER00000000129 2/11 Cross Hyb Matching Probes None
SNAP00000005654 1/11 Cross Hyb Matching Probes None
SNAP00000005655 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005663 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005664 1/11 Cross Hyb Matching Probes None
F15D3.3 2/11 Cross Hyb Matching Probes A 
T28C6.4 1/11 Cross Hyb Matching Probes A 
T28C6.6 1/11 Cross Hyb Matching Probes A 
ZC513.8 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:11497282-11498613(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol col-65
Ensembl K08C9.4
Entrez Gene 187138 Entrez gene
SwissProt Q9XUT4 EMBL-EBI
WormBase CE18860 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB04587 Hypothetical protein K08C9.4 [Caenorhabditis elegans] ref|NP_492936.1| COLlagen family member (col-65) [Caenorhabditis elegans] 4.0E-73
blast CAE69309 Hypothetical protein CBG15367 [Caenorhabditis briggsae] 1.0E-48
blast CAE75248 Hypothetical protein CBG23205 [Caenorhabditis briggsae] 7.0E-16
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 3.4E-24
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.4E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.2E-10
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_492936.1 1 5-27
K08C9.4 1 5-27
SNAP00000013576 1 5-27
GENEFINDER00000013583 1 5-27
Sequence
Target Sequence
>C. ELEGANS:172196_X_AT
ggacagccaggagacgacggtgctccaggaaaggccggagacaacggtcacgacggaatc
ccatccccaattgacgcatatgcccaacacgactgcatcaagtgcccagcaggagcccca
ggaccagcaggacccgacggagaggctggagccccaggaccagacggacagccaggacaa
gacggaccagctggaattgacggtgccccaggagaggccggaccacaaggagatgctgga
gctgctggacaagacggagaggccggagccccgggccccgctggaaagaatggacaacgc
ggacaaggagccccaggaccacaaggaccagaaggaccagccggagctgcaggacaagac
ggtgcaccaggagaggatggagctccaggagcccaaggaactgaaggaatcgccggagca
ccaggaaaagacggagagaccggaccagatggagccgct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGACAGCCAGGAGACGACGGTGCTC 611 525 319 Antisense
GAGACAACGGTCACGACGGAATCCC 573 363 356 Antisense
ATTGACGCATATGCCCAACACGACT 512 5 388 Antisense
CAACACGACTGCATCAAGTGCCCAG 581 189 403 Antisense
AGCAGGACCCGACGGAGAGGCTGGA 673 77 444 Antisense
GACAGCCAGGACAAGACGGACCAGC 112 369 485 Antisense
GAATTGACGGTGCCCCAGGAGAGGC 224 321 512 Antisense
GAGGCCGGACCACAAGGAGATGCTG 155 405 532 Antisense
GATGCTGGAGCTGCTGGACAAGACG 322 413 550 Antisense
CGGGCCCCGCTGGAAAGAATGGACA 68 245 590 Antisense
AGAGACCGGACCAGATGGAGCCGCT 87 69 753 Antisense
Sequence Source Affymetrix Proprietary Database